NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL8490 Query DataSets for GPL8490
Status Public on Apr 27, 2009
Title Illumina HumanMethylation27 BeadChip (HumanMethylation27_270596_v.1.2)
Technology type oligonucleotide beads
Distribution commercial
Organism Homo sapiens
Manufacturer Illumina, Inc.
Manufacture protocol See manufacturer's website
 
Description HumanMethylation27 DNA Analysis BeadChip allows researchers to interrogate 27,578 highly informative CpG sites per sample at single-nucleotide resolution. This 12-sample BeadChip features content derived from the well-annotated NCBI CCDS database (Genome Build 36) and is supplemented with more than 1,000 cancer-related genes described in published literature. Probe content has been enriched to deeply cover more than 150 well-established cancer genes known to show differential methylation patterns. HumanMethylation27 BeadChip content also targets the promoter regions of 110 miRNA genes.
 
Web link http://www.illumina.com/pages.ilmn?ID=243
Submission date Apr 27, 2009
Last update date Jan 02, 2015
Organization Illumina Inc.
E-mail(s) expression@illumina.com, techsupport@illumina.com
Phone 1 800 809 4566
URL http://www.illumina.com
Street address 9885 Towne Centre Drive
City San Diego
State/province CA
ZIP/Postal code 92121
Country USA
 
Samples (18858) GSM401538, GSM401539, GSM401540, GSM401541, GSM401542, GSM401543 
Series (341)
GSE15745 Abundant Quantitative Trait Loci for CpG Methylation and Expression Across Human Brain Tissues
GSE17448 Methylation Pattern of Human Mesenchymal Stromal Cells
GSE17648 Epigenomic Analysis of Aberrantly Methylated Genes in Colorectal Cancer

Data table header descriptions
ID Illumina probe ID
Name
IlmnStrand
AddressA_ID
AlleleA_ProbeSeq
AddressB_ID
AlleleB_ProbeSeq
GenomeBuild
Chr
MapInfo
Ploidy
Species
Source
SourceVersion
SourceStrand
SourceSeq
TopGenomicSeq
Next_Base
Color_Channel
TSS_Coordinate
Gene_Strand
Gene_ID
Symbol
Synonym
Accession
GID
Annotation
Product
Distance_to_TSS
CPG_ISLAND
CPG_ISLAND_LOCATIONS
MIR_CPG_ISLAND
RANGE_GB
RANGE_START
RANGE_END
RANGE_STRAND
GB_ACC
ORF

Data table
ID Name IlmnStrand AddressA_ID AlleleA_ProbeSeq AddressB_ID AlleleB_ProbeSeq GenomeBuild Chr MapInfo Ploidy Species Source SourceVersion SourceStrand SourceSeq TopGenomicSeq Next_Base Color_Channel TSS_Coordinate Gene_Strand Gene_ID Symbol Synonym Accession GID Annotation Product Distance_to_TSS CPG_ISLAND CPG_ISLAND_LOCATIONS MIR_CPG_ISLAND RANGE_GB RANGE_START RANGE_END RANGE_STRAND GB_ACC ORF
cg00000292 cg00000292 TOP 990370 AAACATTAATTACCAACCACTCTTCCAAAAAACACTTACCATTAAAACCA 6660678 AAACATTAATTACCAACCGCTCTTCCAAAAAACACTTACCATTAAAACCG 36 16 28797601 diploid Homo sapiens NCBI:RefSeq 36.1 TOP CGGCCTCAATGGTAAGTGTCCCTTGGAAGAGCGGCTGGTAATTAATGCCC TGGGGTGAGTGAGACCACGGGCCTCACCCCGGACCAAGTTAAGCGGAATCTGGAGAAATA[CG]GCCTCAATGGTAAGTGTCCCTTGGAAGAGCGGCTGGTAATTAATGCCCTCCTGCACCCCC T Red 28797310 + GeneID:487 ATP2A1 ATP2A; SERCA1; NM_173201.2 GI:47132613 isoform a is encoded by transcript variant a; sarcoplasmic/endoplasmic reticulum calcium ATPase 1; calcium pump 1; SR Ca(2+)-ATPase 1; calcium-transporting ATPase sarcoplasmic reticulum type; fast twitch skeletal muscle isoform; endoplasmic reticulum class 1/2 Ca(2+) ATPase; go_component: membrane; go_component: integral to membrane; go_component: sarcoplasmic reticulum; go_component: smooth endoplasmic reticulum; go_function: ATP binding; go_function: hydrolase activity; go_function: nucleotide binding; go_function: calcium ion binding; go_function: magnesium ion binding; go_function: calcium-transporting ATPase activity; go_function: hydrolase activity; acting on acid anhydrides; catalyzing transmembrane movement of substances; go_process: metabolism; go_process: cation transport; go_process: proton transport; go_process: calcium ion transport; go_process: regulation of striated muscle contraction ATPase; Ca++ transporting; fast twitch 1 isoform a 291 TRUE 16:28797486-28797825 NC_000016.8 28797486 28797825 + NM_173201.2 487
cg00002426 cg00002426 TOP 6580397 AATATAATAACATTACCTTACCCATCTTATAATCAAACCAAACAAAAACA 6100343 AATATAATAACATTACCTTACCCGTCTTATAATCAAACCAAACGAAAACG 36 3 57718583 diploid Homo sapiens NCBI:RefSeq 36.1 TOP CGCTCTCGTCTGGTTTGATCACAAGACGGGCAAGGTAATGTCACCACATT CCGCTGTCGACCAGCGCAGAATAATGCCACTTTTGATTGCAAAGTGCTATCAAGGAACCA[CG]CTCTCGTCTGGTTTGATCACAAGACGGGCAAGGTAATGTCACCACATTGTCCAGCGGCAT T Red 57718214 + GeneID:7871 SLMAP SLAP; KIAA1601; NM_007159.2 GI:56550042 Sarcolemmal-associated protein; go_component: integral to plasma membrane; go_component: smooth endoplasmic reticulum; go_function: unfolded protein binding; go_process: protein folding; go_process: muscle contraction sarcolemma associated protein 369 TRUE 3:57716811-57718675 NC_000003.10 57716811 57718675 + NM_007159.2 7871
cg00003994 cg00003994 TOP 7150184 AATAATAATAATACCCCCTATAATACTAACTAACAAACATACCCTCTTCA 7150392 AATAATAATAATACCCCCTATAATACTAACTAACAAACATACCCTCTTCG 36 7 15692387 diploid Homo sapiens NCBI:RefSeq 36.1 BOT GGTGGTGGTGGTGCCCCCTGTGATGCTGGCTGGCAAACATGCCCTCTTCG GGTGGTGGTGGTGGTGGTGGTGGTGCCCCCTGTGATGCTGGCTGGCAAACATGCCCTCTT[CG]TTGGGGTATCCCGCGATTATGCAAGATGAGGAAGAAGTAGAGAGCTCGGGGTAAGACATA T Red 15692819 - GeneID:4223 MEOX2 GAX; MOX2; NM_005924.3 GI:55956906 growth arrest-specific homeo box; go_component: nucleus; go_function: transcription factor activity; go_process: circulation; go_process: development; go_process: regulation of transcription; DNA-dependent mesenchyme homeo box 2 432 TRUE 7:15691512-15693551 NC_000007.12 15691512 15693551 - NM_005924.3 4223
cg00005847 cg00005847 BOT 4850717 TACTATAATACACCCTATATTTAAAACACTAAACTTACCCCATTAAAACA 1260113 TACTATAATACACCCTATATTTAAAACACTAAACTTACCCCATTAAAACG 36 2 176737319 diploid Homo sapiens NCBI:RefSeq 36.1 BOT TACTGTAATGCACCCTGTATTTAAGGCACTGGGCTTGCCCCATTAAAGCG CAGATAACTCAATACTGTAATGCACCCTGTATTTAAGGCACTGGGCTTGCCCCATTAAAG[CG]CCATAAATTTGAAGGCCAATGATCGGTTTTCATGTAACGGGTGGTACTTCATACTGAAGT C Grn 176737051 + GeneID:3232 HOXD3 HOX4; HOX1D; HOX4A; Hox-4.1; MGC10470; NM_006898.4 GI:23510372 homeobox protein Hox-D3; Hox-4.1; mouse; homolog of; homeo box D3; go_component: nucleus; go_function: transcription factor activity; go_process: morphogenesis; go_process: regulation of transcription; DNA-dependent homeobox D3 268 FALSE NM_006898.4 3232
cg00006414 cg00006414 BOT 6980731 CTCAAAAACCAAACAAAACAAAACCCCAATACTAATCATTAATAAAATCA 4280093 CTCGAAAACCGAACAAAACAAAACCCCAATACTAATCGTTAATAAAATCG 36 7 148453770 diploid Homo sapiens NCBI:RefSeq 36.1 BOT CTCGGAAACCGAGCAGGGCAAAACCCCAGTGCTGATCGTTAGTGGGATCG GAACCGGCCCAGCTCGGAAACCGAGCAGGGCAAAACCCCAGTGCTGATCGTTAGTGGGAT[CG]CGCCTGTGAATAGCCACTGCCCTCCAGCCTGGGCAACAGCCAGACCCCGTCTGTTTAATA C Grn 148454441 + GeneID:57541 ZNF398 P51; P71; ZER6; KIAA1339; NM_020781.2 GI:25777702 isoform b is encoded by transcript variant 2; zinc finger DNA binding protein ZER6; zinc finger-estrogen receptor interaction; clone 6; zinc finger DNA binding protein p52/p71; go_component: nucleus; go_function: DNA binding; go_function: zinc ion binding; go_function: metal ion binding; go_function: transcriptional activator activity; go_process: transcription; go_process: regulation of transcription; DNA-dependent zinc finger 398 isoform b 671 TRUE 7:148453584-148455804 NC_000007.12 148453584 148455804 + NM_020781.2 57541
cg00007981 cg00007981 TOP 5260689 CCAAATTCAAAAAACTACAACTAAAACTAACTATAAACAAAATAATCACA 6860356 CCAAATTCAAAAAACTACGACTAAAACTAACTATAAACAAAATAATCACG 36 11 93502242 diploid Homo sapiens NCBI:RefSeq 36.1 BOT CCAAGTTCAAGGGGCTGCGACTGGAGCTGGCTGTGGACAAGATGGTCACG AGCCCACGGAGCCCAAGTTCAAGGGGCTGCGACTGGAGCTGGCTGTGGACAAGATGGTCA[CG]TGCATTGCGGTGGGGCTGCCCCTGCTGCTCATCTCGCTGGCCTTCGCGCAGGAGATCTCG T Red 93501742 + GeneID:24145 PANX1 MRS1; UNQ2529; MGC21309; NM_015368.3 GI:39995063 innexin; go_component: membrane; go_component: gap junction; go_component: integral to membrane pannexin 1 500 TRUE 11:93501124-93502564 NC_000011.8 93501124 93502564 + NM_015368.3 24145
cg00008493 cg00008493 TOP 7200647 CTATCTACCACAATAAATTAAAACCCAACCATCATAATAAACAAAAAACA 2900438 CTATCTACCGCGATAAATTAAAACCCAACCATCATAATAAACGAAAAACG 36 14 92883530 diploid Homo sapiens NCBI:RefSeq 36.1 BOT CTGTCTGCCGCGGTGAGTTGAGGCCCAGCCATCATGGTGGGCGGGAAGCG CGCCAGCGGCCCCTGTCTGCCGCGGTGAGTTGAGGCCCAGCCATCATGGTGGGCGGGAAG[CG]CGTGGCCCTGGCGGGGCGCCCCGACGGGTGGGGAGAAGGGAGGACACGGCGTGCAGGCCT C Grn 92883290 + GeneID:341947 COX8C COX8-3; MGC119774; MGC119775; NM_182971.1 GI:33667031 cytochrome c oxidase subunit VIII isoform 3; go_component: mitochondrion; go_component: integral to membrane; go_component: organelle inner membrane; go_function: oxidoreductase activity; go_function: cytochrome-c oxidase activity; go_process: electron transport cytochrome c oxidase subunit 8C 240 TRUE 14:92883203-92883973 NC_000014.7 92883203 92883973 + NM_182971.1 341947
cg00008713 cg00008713 TOP 6860184 CAAAACAATACAAAATTCTACACAAACCAAAAATAAAACCTATCTCAACA 3780392 CAAAACAATACGAAATTCTACACGAACCGAAAATAAAACCTATCTCAACG 36 18 11970953 diploid Homo sapiens NCBI:RefSeq 36.1 BOT CAGAACAGTACGGAGTTCTGCACGAGCCGGGGGTGGGGCCTGTCTCAGCG GCGCGCTTGACCCAGAACAGTACGGAGTTCTGCACGAGCCGGGGGTGGGGCCTGTCTCAG[CG]CGCGGCGGTGGGGCGGGGCTTGGACACGGGCCCGGCTCAACTTGAGGGAGGCGGGGCTCG C Grn 11971455 + GeneID:3613 IMPA2 NM_014214.1 GI:7657235 inosine monophosphatase 2; go_function: hydrolase activity; go_function: magnesium ion binding; go_function: inositol-1(or 4)-monophosphatase activity; go_process: signal transduction; go_process: phosphate metabolism inositol(myo)-1(or 4)-monophosphatase 2 502 TRUE 18:11970322-11972436 NC_000018.8 11970322 11972436 + NM_014214.1 3613
cg00009407 cg00009407 BOT 4230376 TAACCAAATTCTACTTACAATTATTTTTCTTTTTCCTATTCTCAAACACA 6380376 TAACCGAATTCTACTTACGATTATTTTTCTTTTTCCTATTCTCAAACGCG 36 14 88360674 diploid Homo sapiens NCBI:RefSeq 36.1 TOP CGCGCCTGAGAACAGGAAAAAGAAAAACAACCGCAAGCAGAACTCGGCTA GCGTCCGACTCTGCCCGGCAACCCGCGACGGCTGGGGCCTTGTCCGAGAGGTGCCCGCAG[CG]CGCCTGAGAACAGGAAAAAGAAAAACAACCGCAAGCAGAACTCGGCTACAGGGCTTGCCT C Grn 88360731 + GeneID:123016 TTC8 BBS8; NM_198309.2 GI:53759117 isoform B is encoded by transcript variant 2; Bardet-Biedl syndrome type 8; go_function: binding; go_process: visual perception; go_process: sensory perception tetratricopeptide repeat domain 8 isoform B 57 TRUE 14:88360520-88361283 NC_000014.7 88360520 88361283 + NM_198309.2 123016
cg00010193 cg00010193 BOT 4780008 AAATCAAAACAAACCTAAACACTATTACAACCTAACCAAATATACACACA 1580192 AAATCAAAACGAACCTAAACACTATTACAACCTAACCAAATATACACACG 36 4 1135216 diploid Homo sapiens NCBI:RefSeq 36.1 BOT AAGTCAGGGCGAGCCTGGGCACTGTTGCAGCCTGGCCAGGTGTGCACACG GATCTCAGAGTAAAGTCAGGGCGAGCCTGGGCACTGTTGCAGCCTGGCCAGGTGTGCACA[CG]CTCAGGGCAGTGCTAATACACCAGCCCCCTGCTGCCTCAGCACCCTCCAGACTTTAAGCA C Grn 1135160 + GeneID:401114 FLJ35816 NM_207489.1 GI:46409601 hypothetical protein LOC401114 56 FALSE NM_207489.1 401114
cg00011459 cg00011459 TOP 3120296 AAAAATAATCTACTATCTCCCTTTCAAACTACCCTTCTCCAAACTATACA 7320368 AAAAATAATCTACTATCTCCCTTTCAAACTACCCTTCTCCGAACTATACG 36 16 8797926 diploid Homo sapiens NCBI:RefSeq 36.1 TOP CGCACAGCTCGGAGAAGGGCAGCCTGAAAGGGAGACAGTAGACCATTTCT CCACTGCAGCACCACAGCCCATGGAGAGGCCTTTCCCACACAGCTTTTCCCCGAAACCTA[CG]CACAGCTCGGAGAAGGGCAGCCTGAAAGGGAGACAGTAGACCATTTCTCTCATGGAACTC T Red 8799193 + GeneID:5373 PMM2 CDG1; CDGS; CDG1a; NM_000303.1 GI:4557838 phosphomannomutase activity is deficient in patients with the carbohydrate-deficient glycoprotein syndrome type I (CDG1); go_component: cytoplasm; go_function: isomerase activity; go_function: phosphomannomutase activity; go_function: phosphomannomutase activity; go_process: metabolism; go_process: mannose biosynthesis; go_process: GDP-mannose biosynthesis; go_process: protein amino acid N-linked glycosylation phosphomannomutase 2 1267 FALSE NM_000303.1 5373
cg00012199 cg00012199 BOT 6200228 AAAACTAAAACAATAAAACACACACAATTCTAACTACACAACTATAAACA 6200154 AAAACTAAAACGATAAAACGCACACAATTCTAACTACGCAACTATAAACG 36 14 20220864 diploid Homo sapiens NCBI:RefSeq 36.1 BOT GGGGCTGAGGCGGTGGGACGCACACAATTCTGACTGCGCAACTGTGAACG GTCGGAGAACTGGGGGCTGAGGCGGTGGGACGCACACAATTCTGACTGCGCAACTGTGAA[CG]CCGGAGAGGGCGGGCCTCCAGGCTTAGGCCCGGGCTCCCTGATGTCCTCACTTCCTGCGC C Grn 20222212 + GeneID:6038 RNASE4 RNS4; MGC9306; NM_194430.1 GI:37577169 go_component: cellular component unknown; go_function: hydrolase activity; go_function: nucleic acid binding; go_function: endonuclease activity; go_function: pancreatic ribonuclease activity; go_process: mRNA cleavage ribonuclease; RNase A family; 4 precursor 1348 TRUE 14:20220472-20221241 NC_000014.7 20220472 20221241 + NM_194430.1 6038
cg00012386 cg00012386 BOT 6840377 AATTCAAATTATATTCCTAAACCCCACAATTTACAACTAATACAACCACA 1510390 AATTCGAATTATATTCCTAAACCCCACAATTTACAACTAATACAACCACG 36 1 225989135 diploid Homo sapiens NCBI:RefSeq 36.1 TOP CGTGGTTGTACCAGTTGCAAACTGTGGGGTCCAGGAATACAACTCGAACC GTTTGGAGTGAGGACGGGGCCCAGGGAGATGGCATGGACCGTGCCTTTCATTTCAGGAGA[CG]TGGTTGTACCAGTTGCAAACTGTGGGGTCCAGGAATACAACTCGAACCCCAAAGAGCACA T Red 225989320 + GeneID:116841 C1orf142 SVAP1; FLJ12517; IMAGE3451454; DKFZp686M10160; NM_053052.2 GI:26024192 synonyms: SVAP1; FLJ12517; IMAGE3451454; DKFZp686M10160 hypothetical protein LOC116841 185 TRUE 1:225989127-225990210 NC_000001.9 225989127 225990210 + NM_053052.2 116841
cg00012792 cg00012792 BOT 1340541 AAAATAAAACTATACTAAAATCCACCAAAAACTATAACCCTAACACTCCA 990678 AAAATAAAACTATACTAAAATCCACCAAAAACTATAACCCTAACACTCCG 36 6 8009492 diploid Homo sapiens NCBI:RefSeq 36.1 TOP CGGAGTGTCAGGGCTATAGTTCCTGGTGGATCCCAGCACAGCCTCATCTC GCAGCAAGAAGAGGGACTCCCTGGGGACTGCGGGCTCAGCGCACCTCATTATCAAGGGTA[CG]GAGTGTCAGGGCTATAGTTCCTGGTGGATCCCAGCACAGCCTCATCTCCCAGGCGGCGCC T Red 8009596 - GeneID:81567 TXNDC5 ERP46; UNQ364; EndoPDI; MGC3178; NM_030810.2 GI:42794770 isoform 1 is encoded by transcript variant 1; thioredoxin related protein; endothelial protein disulphide isomerase; go_component: endoplasmic reticulum; go_function: isomerase activity; go_function: electron transporter activity; go_process: anti-apoptosis; go_process: electron transport thioredoxin domain containing 5 isoform 1 104 TRUE 6:8008961-8009913 NC_000006.10 8008961 8009913 - NM_030810.2 81567
cg00013618 cg00013618 BOT 1410673 CCCAAAACTATAATATTTAAAAATTCTCTACCCTCAAAAATCCCTAACCA 670594 CCCAAAACTATAATATTTAAAAATTCTCTACCCTCAAAAATCCCTAACCG 36 22 20710839 diploid Homo sapiens NCBI:RefSeq 36.1 TOP CGGTCAGGGATCCCTGAGGGCAGAGAATTTCCAAACATCACAGTTTTGGG TCAGGCTAGAGGCCCGAGATAGTCAGGGAGGCTGTGGTCCCAGACTTTGAGCCAGAGAAG[CG]GTCAGGGATCCCTGAGGGCAGAGAATTTCCAAACATCACAGTTTTGGGAGCACCGTGAGA C Grn 20710659 + GeneID:3535 180 FALSE 3535
cg00014085 cg00014085 BOT 1240274 ACCTTATTTAAAAACCTTCTTCCTAACCTCCTTATCAATTACCAAAAACA 1780240 ACCTTATTTAAAAACCTTCTTCCTAACCTCCTTATCAATTACCAAAAACG 36 2 85435016 diploid Homo sapiens NCBI:RefSeq 36.1 TOP CGCCCCTGGTAACTGACAAGGAGGCCAGGAAGAAGGTTCTCAAACAAGGT TGGGACTATTCTCTGGCAGCTCCCCGAATCCTTTCTCCGAAGATGTCAAACGGCCCCCAG[CG]CCCCTGGTAACTGACAAGGAGGCCAGGAAGAAGGTTCTCAAACAAGGTAGCAGGAGGGAC C Grn 85435166 - GeneID:54884 RetSat FLJ20296; NM_017750.2 GI:31377747 go_component: nuclear outer membrane; go_component: endoplasmic reticulum membrane; go_function: oxidoreductase activity; go_function: all-trans-retinol 13;14-reductase activity; go_process: electron transport; go_process: retinol metabolism all-trans-13;14-dihydroretinol saturase 150 TRUE 2:85434965-85435723 NC_000002.10 85434965 85435723 - NM_017750.2 54884
cg00014837 cg00014837 TOP 2970333 CCTTACATAATTACCATAAAAATCCCATAAAATAAATACACTATCATTCA 2190632 CCTTACGTAATTACCATAAAAATCCCATAAAATAAATACACTATCATTCG 36 12 6627518 diploid Homo sapiens NCBI:RefSeq 36.1 TOP CGAATGATAGTGTATCTACCTTATGGGATTCCTATGGCAATTACGTAAGG CCTCACGACCTGTTTGTTGGGCGAGTTGCTTCCCTAAGCCCCGATTTCTCATCTGTAAAA[CG]AATGATAGTGTATCTACCTTATGGGATTCCTATGGCAATTACGTAAGGTAGTGCATGTAA T Red 6626841 - GeneID:84519 ACRBP SP32; OY-TES-1; NM_032489.2 GI:17999523 go_component: cellular component unknown; go_function: molecular function unknown; go_process: biological process unknown proacrosin binding protein sp32 precursor 677 FALSE NM_032489.2 84519
cg00015770 cg00015770 BOT 50767 AAACATTTTTTAATCACTAAAATCAAATCTCCCAATACTTTAACTTCCCA 4730626 GAACATTTTTTAATCACTAAAATCGAATCTCCCAATACTTTAACTTCCCG 36 4 122521457 diploid Homo sapiens NCBI:RefSeq 36.1 BOT GAACATTTTTTGGTCACTGAGATCGAGTCTCCCAGTGCTTTGGCTTCCCG TATTTGAACCGCGAACATTTTTTGGTCACTGAGATCGAGTCTCCCAGTGCTTTGGCTTCC[CG]CCTCTTTATCGTGGGTTTGATCCCTGAGCTGCTCTCCTTTCCCGAACCTCCCGGGGTGCA C Grn 122521252 - GeneID:84109 GPR103 AQ27; SP9155; NM_198179.1 GI:38016136 QRFP receptor; go_component: integral to membrane; go_function: receptor activity; go_function: neuropeptide Y receptor activity; go_function: rhodopsin-like receptor activity; go_process: signal transduction; go_process: G-protein coupled receptor protein signaling pathway G protein-coupled receptor 103 205 TRUE 4:122520698-122521834 NC_000004.10 122520698 122521834 - NM_198179.1 84109
cg00016968 cg00016968 BOT 5560324 TCTAAATCCCAACTATAAATTCTATTCCCACTCCTAAATCTAACTTAACA 5560008 TCTAAATCCCAACTATAAATTCTATTCCCACTCCTAAATCTAACTTAACG 36 1 113051971 diploid Homo sapiens NCBI:RefSeq 36.1 TOP CGCCAAGTCAGACCTAGGAGTGGGAACAGAATTCACAGCTGGGATCCAGA TCCCACCTCCTCAGCTCCCTTACAGGGAAAGGAGATACGCGTGTAGGTAAATATCCTATG[CG]CCAAGTCAGACCTAGGAGTGGGAACAGAATTCACAGCTGGGATCCAGAAGCATTTCTAGG C Grn 113051243 - GeneID:389 RHOC ARH9; ARHC; RHOH9; NM_175744.3 GI:34222243 Aplysia RAS-related homolog 9 (oncogene RHO H9); RAS homolog gene family; member C (oncogene RHO H9); Aplysia ras-related homolog 9; go_component: membrane; go_function: GTP binding; go_function: nucleotide binding; go_function: GTPase activity; go_function: signal transducer activity; go_process: small GTPase mediated signal transduction; go_process: positive regulation of I-kappaB kinase/NF-kappaB cascade ras homolog gene family; member C 728 FALSE NM_175744.3 389
cg00019495 cg00019495 BOT 6550136 CCAACCTACTTAAATAACTAAACTAACTAACACAAACTACTAATAACACA 6220044 CCAACCTACTTAAATAACTAAACTAACTAACGCAAACTACTAATAACACG 36 4 57242282 diploid Homo sapiens NCBI:RefSeq 36.1 TOP CGTGCTATCAGCAGCCTGCGTCAGCCAGCCCAGCTATTTAAGCAGGCTGG TGCCCACGCTGCAGGTTTTTCAGGTCCTTGCTCGAGTGTGTGCTCATAGGCGTAAATAAA[CG]TGCTATCAGCAGCCTGCGTCAGCCAGCCCAGCTATTTAAGCAGGCTGGCATCAGCAAACA T Red 57242322 - GeneID:84525 HOP OB1; LAGY; Toto; Cameo; NECC1; SMAP31; MGC20820; NM_032495.4 GI:47717119 lung cancer-associated Y protein; not expressed in choriocarcinoma clone 1; heart odd homeobox 1 protein; go_component: nucleus; go_function: transcription factor activity; go_process: development; go_process: regulation of transcription; DNA-dependent homeodomain-only protein 40 FALSE NM_032495.4 84525

Total number of rows: 27578

Table truncated, full table size 22262 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL8490_HumanMethylation27_270596_v.1.2.csv.gz 5.7 Mb (ftp)(http) CSV

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap