NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL11202 Query DataSets for GPL11202
Status Public on Nov 12, 2010
Title Agilent-026655 Whole Mouse Genome Microarray 4x44K v2 (Probe Name version)
Technology type in situ oligonucleotide
Distribution commercial
Organism Mus musculus
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
 
Description *** The ID column includes the Agilent Probe Names. A different version of this platform with the Agilent Feature Extraction feature numbers in the ID column is assigned accession number GPL10333.
 
Submission date Nov 12, 2010
Last update date Nov 01, 2017
Organization Agilent Technologies
E-mail cag_sales-na@agilent.com
Phone 877-424-4536
URL http://www.agilent.com
Department
Street address
City Palo Alto
State/province CA
ZIP/Postal code 94304
Country USA
 
Samples (2971) GSM622301, GSM622302, GSM622303, GSM769572, GSM769573, GSM769574 
Series (255)
GSE25302 Synergistic Tumor Suppressor Activity of E-cadherin and p53 in a Conditional Mouse Model for Diffuse-Type Gastric Cancer
GSE31074 Essential role of gastric gland mucin in preventing gastric cancer in mice
GSE31405 Differentially expressed genes between oncogene-introduced wild-type and Atf4-/- cells
Relations
Alternative to GPL10333

Data table header descriptions
ID Agilent feature number
SPOT_ID Spot identifier
CONTROL_TYPE Control type
REFSEQ RefSeq Accession number
GB_ACC GenBank Accession number
GENE Entrez Gene ID
GENE_SYMBOL Gene Symbol
GENE_NAME Gene Name
UNIGENE_ID UnigeneID
ENSEMBL_ID EnsemblID
TIGR_ID TIGRID
ACCESSION_STRING Accession String
CHROMOSOMAL_LOCATION Chromosomal Location
CYTOBAND Cytoband
DESCRIPTION Description
GO_ID GoIDs
SEQUENCE Sequence

Data table
ID SPOT_ID CONTROL_TYPE REFSEQ GB_ACC GENE GENE_SYMBOL GENE_NAME UNIGENE_ID ENSEMBL_ID TIGR_ID ACCESSION_STRING CHROMOSOMAL_LOCATION CYTOBAND DESCRIPTION GO_ID SEQUENCE
(+)E1A_r60_1 (+)E1A_r60_1 pos
(+)E1A_r60_3 (+)E1A_r60_3 pos
(+)E1A_r60_a104 (+)E1A_r60_a104 pos
(+)E1A_r60_a107 (+)E1A_r60_a107 pos
(+)E1A_r60_a135 (+)E1A_r60_a135 pos
(+)E1A_r60_a20 (+)E1A_r60_a20 pos
(+)E1A_r60_a22 (+)E1A_r60_a22 pos
(+)E1A_r60_a97 (+)E1A_r60_a97 pos
(+)E1A_r60_n11 (+)E1A_r60_n11 pos
(+)E1A_r60_n9 (+)E1A_r60_n9 pos
(-)3xSLv1 (-)3xSLv1 neg
A_51_P100034 A_51_P100034 FALSE NM_027162 NM_027162 69674 Mif4gd MIF4G domain containing Mm.390387 ref|NM_027162|ref|NM_001243586|ref|NM_001243587|ref|NM_001243584 chr11:115469328-115469269 mm|11qE2 Mus musculus MIF4G domain containing (Mif4gd), transcript variant 1, mRNA [NM_027162] GO:0005488(binding)|GO:0005575(cellular_component)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0006417(regulation of translation)|GO:0008022(protein C-terminus binding)|GO:0016070(RNA metabolic process) GAGACTTTTGTGGAGGAAGCCTGTTTCCTCCAGTCATGAGTGACTGCCTCACCAGGTTGG
A_51_P100174 A_51_P100174 FALSE NM_008613 NM_008613 17427 Mns1 meiosis-specific nuclear structural protein 1 Mm.387671 ENSMUST00000034746 ref|NM_008613|ens|ENSMUST00000034746|gb|D14849|gb|AK132772 chr9:72306274-72306333 mm|9qD Mus musculus meiosis-specific nuclear structural protein 1 (Mns1), mRNA [NM_008613] GO:0003674(molecular_function)|GO:0005634(nucleus)|GO:0005635(nuclear envelope)|GO:0005882(intermediate filament)|GO:0007126(meiosis)|GO:0008150(biological_process) CTGTTTTACAGTTGGTGACAGTAGGCCCTGGTCTATCTGCATGTTCTAAAACATCCTCCT
A_51_P100208 A_51_P100208 FALSE NM_177906 NM_177906 330908 Opcml opioid binding protein/cell adhesion molecule-like Mm.379474 ENSMUST00000115243 ref|NM_177906|ens|ENSMUST00000115243|gb|AK048730|gb|BC076581 chr9:28731887-28731946 mm|9qA4 Mus musculus opioid binding protein/cell adhesion molecule-like (Opcml), mRNA [NM_177906] TTTGGGTTTTCTTTGGCATAAACCTTATTTCTAGAAATCCTCATGTCCAATTGCTTTCCC
A_51_P100289 A_51_P100289 FALSE NM_020493 NM_020493 20807 Srf serum response factor Mm.45044 ENSMUST00000015749 ref|NM_020493|ens|ENSMUST00000015749|tc|TC1577357|tc|TC1718111 chr17:46683795-46683788 mm|17qC Mus musculus serum response factor (Srf), mRNA [NM_020493] GO:0000790(nuclear chromatin)|GO:0001076(RNA polymerase II transcription factor binding transcription factor activity)|GO:0001077(RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription)|GO:0001569(patterning of blood vessels)|GO:0001701(in utero embryonic development)|GO:0001707(mesoderm formation)|GO:0001764(neuron migration)|GO:0001829(trophectodermal cell differentiation)|GO:0001947(heart looping)|GO:0002011(morphogenesis of an epithelial sheet)|GO:0002042(cell migration involved in sprouting angiogenesis)|GO:0002521(leukocyte differentiation)|GO:0003677(DNA binding)|GO:0003682(chromatin binding)|GO:0003700(sequence-specific DNA binding transcription factor activity)|GO:0003705(sequence-specific distal enhancer binding RNA polymerase II transcription factor activity)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0005783(endoplasmic reticulum)|GO:0006351(transcription, DNA-dependent)|GO:0006355(regulation of transcription, DNA-dependent)|GO:0006366(transcription from RNA polymerase II promoter)|GO:0007015(actin filament organization)|GO:0007160(cell-matrix adhesion)|GO:0007275(multicellular organismal development)|GO:0007369(gastrulation)|GO:0007507(heart development)|GO:0007616(long-term memory)|GO:0008134(transcription factor binding)|GO:0008285(negative regulation of cell proliferation)|GO:0008306(associative learning)|GO:0009725(response to hormone stimulus)|GO:0010669(epithelial structure maintenance)|GO:0010735(positive regulation of transcription via serum response element binding)|GO:0010736(serum response element binding)|GO:0016337(cell-cell adhesion)|GO:0021766(hippocampus development)|GO:0022028(tangential migration from the subventricular zone to the olfactory bulb)|GO:0030036(actin cytoskeleton organization)|GO:0030038(contractile actin filament bundle assembly)|GO:0030155(regulation of cell adhesion)|GO:0030168(platelet activation)|GO:0030220(platelet formation)|GO:0030336(negative regulation of cell migration)|GO:0031175(neuron projection development)|GO:0031490(chromatin DNA binding)|GO:0033561(regulation of water loss via skin)|GO:0034097(response to cytokine stimulus)|GO:0035855(megakaryocyte development)|GO:0035912(dorsal aorta morphogenesis)|GO:0042803(protein homodimerization activity)|GO:0043149(stress fiber assembly)|GO:0043565(sequence-specific DNA binding)|GO:0043589(skin morphogenesis)|GO:0045059(positive thymic T cell selection)|GO:0045214(sarcomere organization)|GO:0045597(positive regulation of cell differentiation)|GO:0045893(positive regulation of transcription, DNA-dependent)|GO:0045944(positive regulation of transcription from RNA polymerase II promoter)|GO:0045987(positive regulation of smooth muscle contraction)|GO:0046016(positive regulation of transcription by glucose)|GO:0046716(muscle cell homeostasis)|GO:0046983(protein dimerization activity)|GO:0048589(developmental growth)|GO:0048821(erythrocyte development)|GO:0051491(positive regulation of filopodium assembly)|GO:0055003(cardiac myofibril assembly)|GO:0060218(hemopoietic stem cell differentiation) GGTGTATCCCTAATTAAGTGCCTCTAGGGGTGTGTGCGCGCGCCTGTGTCCTGAGTGAAT
A_51_P100298 A_51_P100298 FALSE NM_152220 NM_152220 20908 Stx3 syntaxin 3 Mm.272264 ENSMUST00000112965 ref|NM_152220|ens|ENSMUST00000112965|ens|ENSMUST00000069285|gb|AK170105 chr19:11859903-11857591 mm|19qA Mus musculus syntaxin 3 (Stx3), transcript variant A, mRNA [NM_152220] GO:0001950(plasma membrane enriched fraction)|GO:0005484(SNAP receptor activity)|GO:0005515(protein binding)|GO:0005886(plasma membrane)|GO:0005911(cell-cell junction)|GO:0006810(transport)|GO:0006836(neurotransmitter transport)|GO:0006886(intracellular protein transport)|GO:0006887(exocytosis)|GO:0006944(cellular membrane fusion)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0016192(vesicle-mediated transport)|GO:0016324(apical plasma membrane)|GO:0030426(growth cone)|GO:0031175(neuron projection development)|GO:0031201(SNARE complex)|GO:0034599(cellular response to oxidative stress)|GO:0042581(specific granule)|GO:0042582(azurophil granule)|GO:0043005(neuron projection)|GO:0050544(arachidonic acid binding) ATCGCCATGCTGGTGGAAAATCAGGGGGAGATGTTAGATAACATAGAGTTGAATGTCATG
A_51_P100309 A_51_P100309 FALSE NM_001039652 NM_001039652 18390 Oprm1 opioid receptor, mu 1 Mm.457998 ENSMUST00000092734 ref|NM_001039652|ens|ENSMUST00000092734|ens|ENSMUST00000056385|ens|ENSMUST00000150374 chr10:3516213-3516154 mm|10qA1 Mus musculus opioid receptor, mu 1 (Oprm1), mRNA [NM_001039652] GO:0004871(signal transducer activity)|GO:0004872(receptor activity)|GO:0004930(G-protein coupled receptor activity)|GO:0004979(beta-endorphin receptor activity)|GO:0004985(opioid receptor activity)|GO:0005624(membrane fraction)|GO:0005886(plasma membrane)|GO:0005925(focal adhesion)|GO:0007165(signal transduction)|GO:0007186(G-protein coupled receptor signaling pathway)|GO:0007191(activation of adenylate cyclase activity by dopamine receptor signaling pathway)|GO:0007193(inhibition of adenylate cyclase activity by G-protein signaling pathway)|GO:0007218(neuropeptide signaling pathway)|GO:0007268(synaptic transmission)|GO:0007610(behavior)|GO:0007626(locomotory behavior)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0030425(dendrite)|GO:0031635(inhibition of adenylate cyclase activity by opioid receptor signaling pathway)|GO:0031681(G-protein beta-subunit binding)|GO:0032100(positive regulation of appetite)|GO:0032590(dendrite membrane)|GO:0032839(dendrite cytoplasm)|GO:0038003(opioid receptor signaling pathway)|GO:0038047(morphine receptor activity)|GO:0042383(sarcolemma)|GO:0043204(perikaryon)|GO:0044424(intracellular part)|GO:0045121(membrane raft)|GO:0051930(regulation of sensory perception of pain)|GO:0060079(regulation of excitatory postsynaptic membrane potential) GCCTGAACCCAGTTCTTTATGCGTTCCTGGATGAAAACTTCAAACGATGTTTTAGAGAGT
A_51_P100327 A_51_P100327 FALSE NM_013683 NM_013683 21354 Tap1 transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) Mm.482076 ENSMUST00000166582 ref|NM_013683|ref|NM_001161730|ens|ENSMUST00000166582|ens|ENSMUST00000041633 chr17:34330854-34330913 mm|17qB1 Mus musculus transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) (Tap1), transcript variant 1, mRNA [NM_013683] GO:0000166(nucleotide binding)|GO:0001916(positive regulation of T cell mediated cytotoxicity)|GO:0005215(transporter activity)|GO:0005524(ATP binding)|GO:0005739(mitochondrion)|GO:0005783(endoplasmic reticulum)|GO:0005792(microsome)|GO:0005886(plasma membrane)|GO:0006200(ATP catabolic process)|GO:0006810(transport)|GO:0006952(defense response)|GO:0008152(metabolic process)|GO:0015031(protein transport)|GO:0015197(peptide transporter activity)|GO:0015421(oligopeptide-transporting ATPase activity)|GO:0015833(peptide transport)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0016887(ATPase activity)|GO:0017111(nucleoside-triphosphatase activity)|GO:0019060(intracellular transport of viral proteins in host cell)|GO:0019885(antigen processing and presentation of endogenous peptide antigen via MHC class I)|GO:0030176(integral to endoplasmic reticulum membrane)|GO:0042270(protection from natural killer cell mediated cytotoxicity)|GO:0042288(MHC class I protein binding)|GO:0042605(peptide antigen binding)|GO:0042626(ATPase activity, coupled to transmembrane movement of substances)|GO:0042803(protein homodimerization activity)|GO:0042825(TAP complex)|GO:0043531(ADP binding)|GO:0046967(cytosol to ER transport)|GO:0046978(TAP1 binding)|GO:0046979(TAP2 binding)|GO:0046980(tapasin binding)|GO:0046982(protein heterodimerization activity)|GO:0055085(transmembrane transport) TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG
A_51_P100347 A_51_P100347 FALSE NM_001033341 NM_001033341 240476 Zfp407 zinc finger protein 407 Mm.329575 ENSMUST00000125763 ref|NM_001033341|gb|AK032536|ens|ENSMUST00000125763|tc|TC1605152 chr18:84731042-84730983 mm|18qE4 Mus musculus zinc finger protein 407 (Zfp407), mRNA [NM_001033341] GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0008150(biological_process) CAAATGAAACTCAGAGGATGTATATGAAACACTTTAGAACACAGATGAAAACAAACGCAC
A_51_P100519 A_51_P100519 FALSE XM_003085003 XM_003085003 Mm.396159 ENSMUST00000062438 ens|ENSMUST00000062438|ref|XM_003085003|ref|XM_003085900|gb|AK016018 chr14:25435102-25435043 mm|14qA3 RIKEN cDNA 4930542C16 gene [Source:MGI Symbol;Acc:MGI:1922413] [ENSMUST00000062438] GCTATCTGTTTTTTCAAACATAGATGTGGAATTAGGAAGTGAGAAAGAAATGGAATCTGG

Total number of rows: 39486

Table truncated, full table size 24780 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap