NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL1073 Query DataSets for GPL1073
Status Public on Mar 19, 2004
Title GNF1M
Technology type in situ oligonucleotide
Distribution non-commercial
Organism Mus musculus
 
Description GNF1M
We identified a non-redundant set of target sequences for the mouse using the following sources: RefSeq (12,029 sequences), Celera (29,331 sequences), and RIKEN (46,299 sequences). First, all sequences were RepeatMasked to remove repetitive elements. Next, sequence identity between individual sequences was established using pairwise BLAT or BLAST and sim4. The results from single-linkage clustering were further triaged to produce a final target set of 36,182 targets with the highest degree of confidence of computational prediction (biasing toward sequences containing Interpro domains and away from non-coding RNAs). The final target sets were submitted to the Affymetrix's chip design pipeline for fabrication of the arrays. For data submission here, only probe sets that mapped to public sequences are given.
 
Submission date Mar 18, 2004
Last update date Jun 16, 2005
Contact name John R Walker
E-mail jwalker@gnf.org
Phone 858-812-1636
Organization name Genomics Institute of the Novartis Research Foundation
Lab Genetics Core
Street address 10675 John Jay Hopkins
City San Diego
State/province CA
ZIP/Postal code 92121
Country USA
 
Samples (310) GSM18584, GSM18585, GSM18586, GSM18587, GSM18588, GSM18589 
Series (9)
GSE1133 tissue-specific pattern of mRNA expression
GSE3746 Circadian skeletal muscle_wt and Clock mutants
GSE3748 Circadian liver_wt and Clock mutants

Data table header descriptions
ID Probe Set Name
Identifier_Source Identifier_Source
Description Description
CLONE_ID clone identifier
Sequence_Type Sequence Type
SEQUENCE
SPOT_ID Column added by GEO staff to facilitate sequence tracking in Entrez GEO
GB_ACC GenBank Accession Number

Data table
ID Identifier_Source Description CLONE_ID Sequence_Type SEQUENCE SPOT_ID GB_ACC
AFFX-18SRNAMur/X00686_3_at GenBank M. musculus /GEN=18S rRNA /DB_XREF=gb:X00686.1 /DEF=Mouse gene for 18S rRNA. Control Sequence X00686.1
AFFX-18SRNAMur/X00686_5_at GenBank M. musculus /GEN=18S rRNA /DB_XREF=gb:X00686.1 /DEF=Mouse gene for 18S rRNA. Control Sequence X00686.1
AFFX-18SRNAMur/X00686_M_at GenBank M. musculus /GEN=18S rRNA /DB_XREF=gb:X00686.1 /DEF=Mouse gene for 18S rRNA. Control Sequence X00686.1
AFFX-b-ActinMur/M12481_3_at GenBank M. musculus /GEN=beta-actin /DB_XREF=gb:M12481.1 /DEF=Mouse cytoplasmic beta-actin mRNA. Control Sequence TTCCATCATGAAGTGTGACGTTGACATCCGTAAAGACCTCTATGCCAACACAGTGCTGTCTGGTGGTACCACCATGTACCCAGGCATTGCTGACAGGATGCAGAAGGAGATTACTGCTCTGGCTCCTAGCACCATGAAGATCAAGATCATTGCTCCTCCTGAGCGCAAGTACTCTGTGTGGATCGGTGGCTCCATCCTGGCCTCACTGTCCACCTTCCAGCAGATGTGGATCAGCAAGCAGGAGTACGATGAGTCCGGCCCCTCCATCGTGCACCGCAAGTGCTTCTAGGCGGACTGTTACTGAGCTGCGTTT M12481.1
AFFX-b-ActinMur/M12481_5_at GenBank M. musculus /GEN=beta-actin /DB_XREF=gb:M12481.1 /DEF=Mouse cytoplasmic beta-actin mRNA. Control Sequence GAAGGACTCCTATGTGGGTGACGAGGCCCAGAGCAAGAGAGGTATCCTGACCCTGAAGTACCCCATTGAACATGGCATTGTTACCAACTGGGACGACATGGAGAAGATCTGGCACCACACCTTCTACAATGAGCTGCGTGTGGCCCCTGAGGAGCACCCTGTGCTGCTCACCGAGGCCCCCCTGAACCCTAAGGCCAACCGTGAAAAGATGACCCAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTAGCCATCCAGGCTGTGCTGTCCCTGTATGCCTCTGGTCGT M12481.1
AFFX-b-ActinMur/M12481_M_at GenBank M. musculus /GEN=beta-actin /DB_XREF=gb:M12481.1 /DEF=Mouse cytoplasmic beta-actin mRNA. Control Sequence ACTACCTCATGAAGATCCTGACCGAGCGTGGCTACAGCTTCACCACCACAGCTGAGAGGGAAATCGTGCGTGACATCAAAGAGAAGCTGTGCTATGTTGCTCTAGACTTCGAGCAGGAGATGGCCACTGCCGCATCCTCTTCCTCCCTGGAGAAGAGCTATGAGCTGCCTGACGGCCAGGTCATCACTATTGGCAACGAGCGGTTCCGATGCCCTGAGGCTCTTTTCCAGCCTT M12481.1
AFFX-BioB-3_at GenBank E. coli /GEN=bioB /DB_XREF=gb:J04423.1 /NOTE=SIF corresponding to nucleotides 2755-3052 of gb:J04423.1 /DEF=E.coli 7,8-diamino-pelargonic acid (bioA), biotin synthetase (bioB), 7-keto-8-amino-pelargonic acid synthetase (bioF), bioC protein, and dethiobiotin synthetase (bioD), complete cds. Control Sequence J04423.1
AFFX-BioB-5_at GenBank E. coli /GEN=bioB /DB_XREF=gb:J04423.1 /NOTE=SIF corresponding to nucleotides 2032-2305 of gb:J04423.1 /DEF=E.coli 7,8-diamino-pelargonic acid (bioA), biotin synthetase (bioB), 7-keto-8-amino-pelargonic acid synthetase (bioF), bioC protein, and dethiobiotin synthetase (bioD), complete cds. Control Sequence J04423.1
AFFX-BioB-M_at GenBank E. coli /GEN=bioB /DB_XREF=gb:J04423.1 /NOTE=SIF corresponding to nucleotides 2482-2739 of gb:J04423.1 /DEF=E.coli 7,8-diamino-pelargonic acid (bioA), biotin synthetase (bioB), 7-keto-8-amino-pelargonic acid synthetase (bioF), bioC protein, and dethiobiotin synthetase (bioD), complete cds. Control Sequence J04423.1
AFFX-BioC-3_at GenBank E. coli /GEN=bioC /DB_XREF=gb:J04423.1 /NOTE=SIF corresponding to nucleotides 4626-4878 of gb:J04423.1 /DEF=E.coli 7,8-diamino-pelargonic acid (bioA), biotin synthetase (bioB), 7-keto-8-amino-pelargonic acid synthetase (bioF), bioC protein, and dethiobiotin synthetase (bioD), complete cds. Control Sequence J04423.1
AFFX-BioC-5_at GenBank E. coli /GEN=bioC /DB_XREF=gb:J04423.1 /NOTE=SIF corresponding to nucleotides 4218-4566 of gb:J04423.1 /DEF=E.coli 7,8-diamino-pelargonic acid (bioA), biotin synthetase (bioB), 7-keto-8-amino-pelargonic acid synthetase (bioF), bioC protein, and dethiobiotin synthetase (bioD), complete cds. Control Sequence J04423.1
AFFX-BioDn-3_at GenBank E. coli /GEN=bioD /DB_XREF=gb:J04423.1 /NOTE=SIF corresponding to nucleotides 5286-5570 of gb:J04423.1, not 100% identical /DEF=E.coli 7,8-diamino-pelargonic acid (bioA), biotin synthetase (bioB), 7-keto-8-amino-pelargonic acid synthetase (bioF), bioC protein, and dethiobiotin synthetase (bioD), complete cds. Control Sequence J04423.1
AFFX-BioDn-5_at GenBank E. coli /GEN=bioD /DB_XREF=gb:J04423.1 /NOTE=SIF corresponding to nucleotides 4980-5256 of gb:J04423.1, not 100% identical /DEF=E.coli 7,8-diamino-pelargonic acid (bioA), biotin synthetase (bioB), 7-keto-8-amino-pelargonic acid synthetase (bioF), bioC protein, and dethiobiotin synthetase (bioD), complete cds. Control Sequence J04423.1
AFFX-CreX-3_at GenBank Bacteriophage P1 /GEN=cre /DB_XREF=gb:X03453.1 /NOTE=SIF corresponding to nucleotides 1089-1495 of gb:X03453.1 /DEF=Bacteriophage P1 cre gene for recombinase protein. Control Sequence X03453.1
AFFX-CreX-5_at GenBank Bacteriophage P1 /GEN=cre /DB_XREF=gb:X03453.1 /NOTE=SIF corresponding to nucleotides 513-1047 of gb:X03453.1 /DEF=Bacteriophage P1 cre gene for recombinase protein. Control Sequence X03453.1
AFFX-DapX-3_at GenBank B. subtilis /GEN=jojG /DB_XREF=gb:L38424.1 /NOTE=SIF corresponding to nucleotides 2684-3130 of gb:L38424.1 /DEF=Bacillus subtilis dihydropicolinate reductase (jojE) gene, complete cds; poly(A) polymerase (jojI) gene, complete cds; biotin acetyl-CoA-carboxylase ligase (birA) gene, complete cds; jojC, jojD, jojF, jojG, jojH genes, complete cds s. Control Sequence L38424.1
AFFX-DapX-5_at GenBank B. subtilis /GEN=dapB /DB_XREF=gb:L38424.1 /NOTE=SIF corresponding to nucleotides 1428-1926 of gb:L38424.1 /DEF=Bacillus subtilis dihydropicolinate reductase (jojE) gene, complete cds; poly(A) polymerase (jojI) gene, complete cds; biotin acetyl-CoA-carboxylase ligase (birA) gene, complete cds; jojC, jojD, jojF, jojG, jojH genes, complete cds s. Control Sequence L38424.1
AFFX-DapX-M_at GenBank B. subtilis /GEN=dapB, jojF /DB_XREF=gb:L38424.1 /NOTE=SIF corresponding to nucleotides 2020-2580 of gb:L38424.1, not 100% identical /DEF=Bacillus subtilis dihydropicolinate reductase (jojE) gene, complete cds; poly(A) polymerase (jojI) gene, complete cds; biotin acetyl-CoA-carboxylase ligase (birA) gene, complete cds; jojC, jojD, jojF, jojG, jojH genes, complete cds s. Control Sequence L38424.1
AFFX-GapdhMur/M32599_3_at GenBank M. musculus /GEN=gapd /DB_XREF=gb:M32599.1 /DEF=Mouse glyceraldehyde-3-phosphate dehydrogenase mRNA, complete cds. Control Sequence GGGCCCACTGAAGGGCATCTTGGGCTACACTGAGGACCAGGTTGTCTCCTGCGACTTCAACAGCAACTCCCACTCTTCCACCTTCGATGCCGGGGCTGGCATTGCTCTCAATGACAACTTTGTCAAGCTCATTTCCTGGTATGACAATGAATACGGCTACAGCAACAGGGTGGTGGACCTCATGGCCTACATGGCCTCCAAGGAGTAAGAAACCCTGGACCACCCACCCCAGCAAGGACACTGAGCAAGAGAGGCCCTATCCCAACTCGGCCCCCAACACTGAGCATCTCCCTCACAATTTCCATCCCAGACC M32599.1
AFFX-GapdhMur/M32599_5_at GenBank M. musculus /GEN=gapd /DB_XREF=gb:M32599.1 /DEF=Mouse glyceraldehyde-3-phosphate dehydrogenase mRNA, complete cds. Control Sequence TGGTCACCAGGGCTGCCATTTGCAGTGGCAAAGTGGAGATTGTTGCCATCAACGACCCCTTCATTGACCTCAACTACATGGTCTACATGTTCCAGTATGACTCCACTCACGGCAAATTCAACGGCACAGTCAAGGCCGAGAATGGGAAGCTTGTCATCAACGGGAAGCCCATCACCATCTTCCAGGAGCGAGACCCCACTAACATCAAATGGGGTGAGGCCGGTGCTGAGTATGTCGTGGAGTCTACTGGTGTCTTCACCACCATGGAGAAGGCCGGGGCCCACTTGAAGGGTGGAGCCAAACGGGTCATCATCTCCGCC M32599.1

Total number of rows: 31373

Table truncated, full table size 16769 Kbytes.






Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL1073.CDF.gz 10.0 Mb (ftp)(http) CDF
GPL1073.CIF.gz 1.6 Kb (ftp)(http) CIF
GPL1073.GIN.gz 837.4 Kb (ftp)(http) GIN
GPL1073.PSI.gz 187.1 Kb (ftp)(http) PSI
GPL1073.SIF.gz 3.8 Mb (ftp)(http) SIF
GPL1073.probe.gz 6.3 Mb (ftp)(http) PROBE
GPL1073.tab.gz 6.0 Mb (ftp)(http) TAB

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap