NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL15342 Query DataSets for GPL15342
Status Public on Jan 01, 2013
Title Agilent-019788 Ambystoma mexicanum 44k_v3_20080327 [ProbeName version]
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Ambystoma mexicanum
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
 
Description This platform is the Probe Name version of GPL15341. Please use GPL15341 for Feature Number version.
Arrays of this design have barcodes that begin with 16019788 or 2519788.
Orientation:
Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.
The ID column represents the Agilent Feature Extraction feature number.
Rows and columns are numbered as scanned by an Axon Scanner (barcode on the bottom, DNA on the front surface).
To match data scanned on an Axon scanner, use the RefNumber column contained in the Agilent-provided GAL file as the ID_REF column in sample submissions.
 
Contributor(s) Knapp D, Schulz H, Rascon CA, Volkmer M, Scholz J, Nacu E, Le M, Tazaki A, Novozhilov S, Protze S, Jacob T, Huebner N, Habermann B, Tanaka EM
Submission date Mar 12, 2012
Last update date May 29, 2013
Contact name Dunja Knapp
E-mail(s) dunja.knapp@crt-dresden.de
Phone +49-351-458-82035
Organization name DFG-Center for Regenerative Therapies Dresden
Street address Fetscherstra├če 105
City Dresden
ZIP/Postal code 01307
Country Germany
 
Samples (80) GSM893961, GSM893962, GSM893963, GSM893964, GSM893965, GSM893966 
Series (1)
GSE36451 Comparative Transcriptional Profiling of the Axolotl Limb Identifies a Tripartite Regeneration-Specific Gene Program
Relations
Alternative to GPL15341

Data table header descriptions
ID NAME
SPOT_ID Spot identifier
CONTROL_TYPE Control type
CONTIG_ID the contig information located at http://est.age.mpg.de/cgi-bin/result.py
TARGET_CONTIG_STRAND sngl,s.dbl, NCBI, other= sense strand, a.dbl=antisense strand
CHROMOSOMAL_LOCATION Chromosomal Location
REFSEQ HUMAN HOMOLOG the presumptive human gene ortholog Refseq ID
GI
GENE_SYMBOL the presumptive human gene ortholog symbol
GENE_NAME the presumptive human gene ortholog name
E-VALUE E-value
SEQUENCE Oligo Sequence

Data table
ID SPOT_ID CONTROL_TYPE CONTIG_ID TARGET_CONTIG_STRAND CHROMOSOMAL_LOCATION REFSEQ HUMAN HOMOLOG GI GENE_SYMBOL GENE_NAME E-VALUE SEQUENCE
(+)E1A_r60_1 (+)E1A_r60_1 pos
(+)E1A_r60_3 (+)E1A_r60_3 pos
(+)E1A_r60_a104 (+)E1A_r60_a104 pos
(+)E1A_r60_a107 (+)E1A_r60_a107 pos
(+)E1A_r60_a135 (+)E1A_r60_a135 pos
(+)E1A_r60_a20 (+)E1A_r60_a20 pos
(+)E1A_r60_a22 (+)E1A_r60_a22 pos
(+)E1A_r60_a97 (+)E1A_r60_a97 pos
(+)E1A_r60_n11 (+)E1A_r60_n11 pos
(+)E1A_r60_n9 (+)E1A_r60_n9 pos
(+)eQC-39 (+)eQC-39 pos
(+)eQC-40 (+)eQC-40 pos
(+)eQC-41 (+)eQC-41 pos
(+)eQC-42 (+)eQC-42 pos
(-)3xSLv1 (-)3xSLv1 neg
CUST_10002_PI256017352 CUST_10002_PI256017352 FALSE NCBI_AF064803.1 a.dbl-NCBI_AF064803.1 unmapped NP_000541.1 4507757 TYRP1 tyrosinase-related protein 1 0.00e+00 AGTTGTTGAAGAAGCGGGTCGGCCATTGCTCCCGGTCATCCACTCCATCGTGTGGATACT
CUST_10008_PI256121980 CUST_10008_PI256121980 FALSE ET_Am_asm_2180 sngl-ET_Am_asm_2180 unmapped NP_004385.1 4758120 DAP death-associated protein 2.80e-31 TTTCAGTTGGGATTTTCTCTCCTTTGTGTGCCTTTCGCAATAAATCCTTGTTGAATGGTG
CUST_10009_PI256121980 CUST_10009_PI256121980 FALSE ET_Am_asm_2180 sngl-ET_Am_asm_2180 unmapped NP_004385.1 4758120 DAP death-associated protein 2.80e-31 CCTCTTTAAGATGCCCAGCCACTTCAATCAATTTTATTTTCTATTGATGTTGGAAAGAAC
CUST_1000_PI256121980 CUST_1000_PI256121980 FALSE ET_Am_NT018C_B12 sngl-ET_Am_NT018C_B12 unmapped NP_060533.2 21914927 HELLS helicase, lymphoid-specific 1.17e-75 ATATTTTTGGTCAGCACACGGGCAGGTGGCCTTGGTATTAACTTAACTGCTGCTGATACA
CUST_10010_PI256017352 CUST_10010_PI256017352 FALSE RV_Am_nm_6_e7_t3_.ab1asm_4445 a.dbl-RV_Am_nm_6_e7_t3_.ab1asm_4445 unmapped no hit ACTGAGTCATGTATACCTGTGTGATAAGCCTAAGGGTTATGGGGTGCTGCATTAGGCAAG

Total number of rows: 43797

Table truncated, full table size 9314 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap