|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Feb 18, 2021 |
Title |
43553_3_B8: SS2 Aged Trem2ko White Matter A9 50 |
Sample type |
SRA |
|
|
Source name |
A9
|
Organism |
Mus musculus |
Characteristics |
strain: Trem2ko age: 20 months Sex: female genotype: Trem2ko tissue: White Matter cell_type: Microglia technology: scRNA-seq Smart-seq2
|
Extracted molecule |
total RNA |
Extraction protocol |
The mice were deeply anesthetized and perfused with cold HBSS between 9am-11am (to decrease circadian fluctuations). Each brain was removed and under a dissection microscope individually micro-dissected; grey matter was isolated from the frontal cortex and white matter form optic tract, medial lemniscus and corpus callosum (attached grey matter and choroid plexus were removed carefully) isolated. We developed and established a microglia isolation protocol that prevents ex-vivo transcription and automatizes the mechanical isolation parts using GentleMacs with the Neural Tissue Dissociation Kit (Papain) (Miltenyi Biotec). We added actinomycin D (Act-D, Sigma, No. A1410) to a final concentration of 45 μM into the dissociation solution and enzyme mix to prevent ex-vivo transcription. The dissociated cell suspension was passed through a 70 μm cell strainer (Corning, 352350) before labeling. Subsequently, cells were blocked with mouse FcR-blocking reagent (CD16/CD32 Monoclonal Antibody, eBioscience cat:14-0161-82,1100) and then stained for 15 min using 7AAD (Thermo Fisher, A1310, 25 ug/mL) and the antibodies against CD45 (eFluor 450, 30-F11, eBioscience,Cat.:48-0451-82, 1:200) and CD11b (PE/Cy7,M1/70, eBioscience, Cat:48-0451-82,1:200) and after washed with PBS (Sigma, D8537). Viable (7AAD negative) single immune cells (CD45 and CD11b positive cells) were sorted by flow cytometry (SH800; Sony). For GFP positive microglia from CX3CR1GFP/+ mice, cells were either dissociated with Act-D or without and labeled with DAPI (4’,6-diamidino-2-phenylindole, 1:4000 dilution; Sigma) to label dead cells. After FSC-A/FSC-H selection of single-cells, DAPI negative and GFP positive cells were selected. Single immune cells (CD45 and CD11b positive cells) were sorted by flow cytometry (SH800; Sony). Flow cytometry data were analyzed using FlowJo v10. Single-cells were sorted into 96 well plates filled with 4 μL lysis buffer containing 0.05% Triton X-100 (Sigma) and, ERCC (External RNA Controls Consortium) RNA spike-in Mix (Ambion, Life Technologies) (1:24000000 dilution), 2.5 μM oligo-dT, 2.5 mM dNTP and 2 U/μL of recombinant RNase inhibitor (Clontech) then spun down and frozen at -80°C. Plates were thawed and libraries prepared as described below. The 96-well plates containing the sorted single cells were first thawed and then incubated for 3 min at 72°C and thereafter immediately placed on ice. To perform reverse transcription (RT) we added each well a mix of 0.59 μL H2O, 0.5 μL SMARTScribe™ Reverse Transcriptase (Clontech), 2 μL 5x First Strand buffer, 0.25 μL Recombinant RNase Inhibitor (Clontech), 2 μL Betaine (5 M Sigma), 0.5 μL DTT (100 mM) 0.06 μL MgCl2 (1 M Sigma), 0.1 μL Template-switching oligos (TSO) (100 μM AAGCAGTGGTATCAACGCAGAGTACrGrG+G). Next RT reaction mixes were incubated at 42°C for 90 min followed by 70°C for 5 min and 10 cycles of 50°C 2 min, 42°C 2 min; finally ending with 70°C for 5 min for enzyme inactivation. Pre-amplification of cDNA was performed by adding 12.5 μL KAPA HiFi Hotstart 2x (KAPA Biosystems), 2.138 μL H2O, 0.25 μL ISPCR primers (10 μM, 5′ AAGCAGTGGTATCAACGCAGAGT-3), 0.1125 μL Lambda Exonuclease under the following conditions: 37°C for 30 min, 95°C for 3 min, 23 cycles of (98°C for 20 sec, 67°C for 15 sec, 72°C for 4 min), and a final extension at 72°C for 5 min. Libraries were then cleaned using AMPure bead (Beckman-Coulter) cleanup at a 0.7:1 ratio of beads to PCR product. Libraries were assessed by Bio-analyzer (Agilent 2100), using the High Sensitivity DNA analysis kit, and also fluorometrically using Qubit’s DNA HS assay kits and a Qubit 4.0 Fluorometer (Invitrogen, LifeTechnologies) to measure the concentrations. Further selection of samples was performed via qPCR assay against ubiquitin transcripts Ubb77 (primer 1 5’-GGAGAGTCCATCGTGGTTATTT-3’ primer 2 5’-ACCTCTAGGGTGATGGTCTT-3’, probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/µL. Sequencing libraries were constructed by using in-house produced Tn5 transposase (Picelli et al., 2014). Libraries were barcoded and pooled then underwent three 3 rounds of AMPure bead (Beckman-Coulter) cleanup at a 0.8:1 ratio of beads to library. Libraries were sequenced 2x150 reads base pairs (bp) paired-end on Illumina HiSeq4000 to a depth of 3x105–6x105 reads/sample. scRNA-seq with Smart-seq2
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 4000 |
|
|
Description |
processed data file: 10xaged.tsv
|
Data processing |
BCL files were demultiplexed with the bcl2fastq software from Illumina. Quality was assessed with FastQC Trimming and QC filtering was performed with trim-galore and following command trim_galore -j 2 --paired -q 20 --nextera --stringency 1 Reads were aligned using rnaSTAR (Dobin et al., 2013). Read counts were collected using the parameter “quantMode GeneCounts” of rnaSTAR and using the unstranded values. For 10x datasets, fastq files were processed with Cell Ranger v4 Genome_build: mm10 Supplementary_files_format_and_content: 5x expression matrices of raw counts as tab-separated files, for each dataset. First (unnamed) column are the gene names, each column depicts a single-cell.
|
|
|
Submission date |
Feb 10, 2021 |
Last update date |
Feb 18, 2021 |
Contact name |
Ozgun Gokce |
E-mail(s) |
ozguengoekce@gmail.com
|
Organization name |
Institute for Stroke and Dementia Research
|
Lab |
Systems Neuroscience
|
Street address |
Feodor-Lynen-Strasse 17
|
City |
Munich |
ZIP/Postal code |
81377 |
Country |
Germany |
|
|
Platform ID |
GPL21103 |
Series (1) |
GSE166548 |
White matter aging drives microglial diversity |
|
Relations |
BioSample |
SAMN17859560 |
SRA |
SRX10067908 |
Supplementary data files not provided |
SRA Run Selector |
Raw data are available in SRA |
Processed data are available on Series record |
|
|
|
|
|