U.S. flag

An official website of the United States government

NM_003977.4(AIP):c.805_825dup (p.Phe269_His275dup) AND Hereditary cancer-predisposing syndrome

Germline classification:
Pathogenic (1 submission)
Last evaluated:
Oct 17, 2019
Review status:
1 star out of maximum of 4 stars
criteria provided, single submitter
Somatic classification
of clinical impact:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Somatic classification
of oncogenicity:
None
Review status:
(0/4) 0 stars out of maximum of 4 stars
no assertion criteria provided
Record status:
current
Accession:
RCV001027111.3

Allele description [Variation Report for NM_003977.4(AIP):c.805_825dup (p.Phe269_His275dup)]

NM_003977.4(AIP):c.805_825dup (p.Phe269_His275dup)

Gene:
AIP:aryl hydrocarbon receptor interacting protein [Gene - OMIM - HGNC]
Variant type:
Duplication
Cytogenetic location:
11q13.2
Genomic location:
Preferred name:
NM_003977.4(AIP):c.805_825dup (p.Phe269_His275dup)
HGVS:
  • NC_000011.10:g.67490805_67490825dup
  • NG_008969.1:g.12772_12792dup
  • NM_001302959.2:c.628_648dup
  • NM_001302960.2:c.797_817dup
  • NM_003977.4:c.805_825dupMANE SELECT
  • NP_001289888.1:p.Phe210_His216dup
  • NP_001289889.1:p.Leu266_Pro272dup
  • NP_003968.3:p.Phe269_His275dup
  • LRG_460t1:c.805_825dup
  • LRG_460:g.12772_12792dup
  • NC_000011.9:g.67258273_67258274insACTTCAAGCGGGGCAAGGCCC
  • NC_000011.9:g.67258276_67258296dup
  • NM_003977.2:c.805_825dupTTCAAGCGGGGCAAGGCCCAC
Links:
dbSNP: rs267606578
NCBI 1000 Genomes Browser:
rs267606578
Molecular consequence:
  • NM_001302959.2:c.628_648dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_001302960.2:c.797_817dup - inframe_insertion - [Sequence Ontology: SO:0001821]
  • NM_003977.4:c.805_825dup - inframe_insertion - [Sequence Ontology: SO:0001821]

Condition(s)

Name:
Hereditary cancer-predisposing syndrome
Synonyms:
Neoplastic Syndromes, Hereditary; Tumor predisposition; Cancer predisposition; See all synonyms [MedGen]
Identifiers:
MONDO: MONDO:0015356; MeSH: D009386; MedGen: C0027672

Recent activity

Clear Turn Off Turn On

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...

Assertion and evidence details

Help
Submission AccessionSubmitterReview Status
(Assertion method)		Clinical Significance
(Last evaluated)		OriginMethodCitations
SCV001189617Ambry Genetics
criteria provided, single submitter

(Ambry Variant Classification Scheme 2023)		Pathogenic
(Oct 17, 2019) 		germlineclinical testing

PubMed (5)
[See all records that cite these PMIDs]

Citation Link

Help

Summary from all submissions

EthnicityOriginAffectedIndividualsFamiliesChromosomes testedNumber TestedFamily historyMethod
not providedgermlineunknownnot providednot providednot providednot providednot providedclinical testing

Citations

PubMed

Characterization of aryl hydrocarbon receptor interacting protein (AIP) mutations in familial isolated pituitary adenoma families.

Igreja S, Chahal HS, King P, Bolger GB, Srirangalingam U, Guasti L, Chapple JP, Trivellin G, Gueorguiev M, Guegan K, Stals K, Khoo B, Kumar AV, Ellard S, Grossman AB, Korbonits M; International FIPA Consortium..

Hum Mutat. 2010 Aug;31(8):950-60. doi: 10.1002/humu.21292.

PubMed [citation]
PMID:
20506337
PMCID:
PMC3065644

Germline AIP mutations in apparently sporadic pituitary adenomas: prevalence in a prospective single-center cohort of 443 patients.

Cazabat L, Bouligand J, Salenave S, Bernier M, Gaillard S, Parker F, Young J, Guiochon-Mantel A, Chanson P.

J Clin Endocrinol Metab. 2012 Apr;97(4):E663-70. doi: 10.1210/jc.2011-2291. Epub 2012 Feb 8.

PubMed [citation]
PMID:
22319033
See all PubMed Citations (5)

Details of each submission

From Ambry Genetics, SCV001189617.4

#EthnicityIndividualsChromosomes TestedFamily HistoryMethodCitations
1not providednot providednot providednot providedclinical testing PubMed (5)

Description

The c.805_825dup21 pathogenic mutation (also known as p.F269_H275dup), located in coding exon 6 of the AIP gene, results from an in-frame duplication of 21 nucleotides at nucleotide positions 805 to 825. This results in the duplication of 7 extra residues (FKRGKAH) between codons 269 and 275. This duplication has been reported in multiple individuals with familial isolated pituitary adenomas (FIPA) resulting in gigantism and/or acromegaly, although some carriers in these families remained unaffected (Leontiou CA et al. J. Clin. Endocrinol. Metab. 2008 Jun;93(6):2390-401; Igreja S. et al. Hum. Mutat. 2010 Aug;31(8):950-60; Salvatori R. et al. Eur. J. Endocrinol. 2017 Sep;177(3):257-266; Cazabat L et al. J. Clin Endocrinol. Metab. 2012 Apr;97(4):E663-70). One affected individual also developed a GIST (Hernandez-Ramire LC et al. J. Clin. Endocrinol. Metab. 2015 Sep;100(9):E1242-54). Authors of one study proposed replication slipage as the mechanism for this duplication and report this as an English founder mutation due to a shared haplotype around AIP in affected, unrelated individuals (Salvatori R. et al. Eur. J. Endocrinol. 2017 Sep;177(3):257-266). In addition, co-immunoprecipitation with this AIP mutant and HSP90 showed lack of interaction between these two proteins, resulting in reduced protein stability (Salvatori R. et al. Eur. J. Endocrinol. 2017 Sep;177(3):257-266). Furthermore, this variant was not reported in population-based cohorts in the Genome Aggregation Database (gnomAD). Of note, this mutation is also referred to as c.794_823dup (p.A247_H275ins10) in published literature. Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation.

#SampleMethodObservation
OriginAffectedNumber testedTissuePurposeMethodIndividualsAllele frequencyFamiliesCo-occurrences
1germlineunknownnot providednot providednot providednot providednot providednot providednot provided

Last Updated: May 1, 2024