Skip to main page content
Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_003977.4(AIP):c.805_825dup (p.Phe269_His275dup)

Help
Interpretation:
Pathogenic​

Review status:
criteria provided, multiple submitters, no conflicts
Submissions:
3 (Most recent: Jan 7, 2021)
Last evaluated:
Jan 31, 2020
Accession:
VCV000041208.5
Variation ID:
41208
Description:
21bp duplication
Help

NM_003977.4(AIP):c.805_825dup (p.Phe269_His275dup)

Allele ID
49630
Variant type
Duplication
Variant length
21 bp
Cytogenetic location
11q13.2
Genomic location
11: 67490802-67490803 (GRCh38) GRCh38 UCSC
11: 67258273-67258274 (GRCh37) GRCh37 UCSC
HGVS
Nucleotide Protein Molecular
consequence
NC_000011.10:g.67490805_67490825dup
NC_000011.9:g.67258276_67258296dup
NG_008969.1:g.12772_12792dup
... more HGVS
Protein change
-
Other names
-
Canonical SPDI
NC_000011.10:67490802:ACTTCAAGCGGGGCAAGGCCCAC:ACTTCAAGCGGGGCAAGGCCCACTTCAAGCGGGGCAAGGCCCAC
Functional consequence
-
Global minor allele frequency (GMAF)
-

Allele frequency
-
Links
ClinGen: CA344192
dbSNP: rs267606578
VarSome
Help

Aggregate interpretations per condition

Interpreted condition Interpretation Number of submissions Review status Last evaluated Variation/condition record
Pathogenic 1 criteria provided, single submitter Oct 17, 2019 RCV001027111.1
Pathogenic 1 criteria provided, single submitter Jan 31, 2020 RCV001386204.1
Pathogenic 1 no assertion criteria provided Jun 21, 2012 RCV000034107.3
Help
Gene OMIM ClinGen Gene Dosage Sensitivity Curation Variation viewer Related variants
HI score Help TS score Help Within gene All
AIP - - GRCh38
GRCh37
375 392

Submitted interpretations and evidence

Help
Interpretation
(Last evaluated)
Review status
(Assertion criteria)
Condition
(Inheritance)
Submitter Supporting information
Pathogenic
(Oct 17, 2019)
criteria provided, single submitter
Method: clinical testing
Hereditary cancer-predisposing syndrome
Allele origin: germline
Ambry Genetics
Accession: SCV001189617.2
Submitted: (Nov 30, 2020)
Evidence details
Publications
PubMed (5)
Comment:
The c.805_825dup21 pathogenic mutation (also known as p.F269_H275dup), located in coding exon 6 of the AIP gene, results from an in-frame duplication of 21 nucleotides … (more)
Pathogenic
(Jan 31, 2020)
criteria provided, single submitter
Method: clinical testing
not provided
Allele origin: germline
Invitae
Accession: SCV001586343.1
Submitted: (Jan 07, 2021)
Evidence details
Publications
PubMed (2)
Comment:
This variant, c.805_825dup, results in the insertion of 7 amino acid(s) to the AIP protein (p.Phe269_His275dup), but otherwise preserves the integrity of the reading frame. … (more)
pathologic
(Jun 21, 2012)
no assertion criteria provided
Method: curation
AIP-Related Familial Isolated Pituitary Adenomas
Allele origin: not provided
GeneReviews
Accession: SCV000058037.2
Submitted: (Mar 26, 2013)
Evidence details
Comment:
Converted during submission to Pathogenic.

Functional evidence

Help
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Citations for this variant

Help
Title Author Journal Year Link
<i>AIP</i> Familial Isolated Pituitary Adenomas Korbonits M - 2020 PMID: 22720333
Reduced protein expression of the phosphodiesterases PDE4A4 and PDE4A8 in AIP mutation positive somatotroph adenomas. Bizzi MF Molecular and cellular endocrinology 2018 PMID: 29729370
In-frame seven amino-acid duplication in <i>AIP</i> arose over the last 3000 years, disrupts protein interaction and stability and is associated with gigantism. Salvatori R European journal of endocrinology 2017 PMID: 28634279
Landscape of Familial Isolated and Young-Onset Pituitary Adenomas: Prospective Diagnosis in AIP Mutation Carriers. Hernández-Ramírez LC The Journal of clinical endocrinology and metabolism 2015 PMID: 26186299
Germline AIP mutations in apparently sporadic pituitary adenomas: prevalence in a prospective single-center cohort of 443 patients. Cazabat L The Journal of clinical endocrinology and metabolism 2012 PMID: 22319033
Characterization of aryl hydrocarbon receptor interacting protein (AIP) mutations in familial isolated pituitary adenoma families. Igreja S Human mutation 2010 PMID: 20506337

Text-mined citations for rs267606578...

Help
These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Oct 24, 2021