GEO Profile Links for Gene (Select 77337) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1421

<< First< Prev

Page of 72

Next >Last >>

Select item 1037516251.

Akr1c21 - Pan-peroxisome proliferator-activated receptor agonist effect on various tissues: dose response

Annotation:: Akr1c21, aldo-keto reductase family 1, member C21

Organism:: Mus musculus

Reporter:: GPL1261, 1451030_at (ID_REF), GDS4806, 77337 (Gene ID)

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 103751625

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 905572252.

Akr1c21 - HIV-associated nephropathy model: kidney

Annotation:: Akr1c21, aldo-keto reductase family 1, member C21

Organism:: Mus musculus

Reporter:: GPL1261, 1451030_at (ID_REF), GDS4220, 77337 (Gene ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 90557225

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 874718253.

Akr1c21 - Heart, kidney and lung during juvenile growth

Annotation:: Akr1c21, aldo-keto reductase family 1, member C21

Organism:: Mus musculus

Reporter:: GPL1261, 1451030_at (ID_REF), GDS4316, 77337 (Gene ID)

DataSet type:: Expression profiling by array, count, 40 samples

ID:: 87471825

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 644446564.

Akr1c21 - Hypertension model: kidney

Annotation:: Akr1c21, aldo-keto reductase family 1, member C21

Organism:: Mus musculus

Reporter:: GPL9734, 100081530_TGI_at (ID_REF), GDS3675, NM_029901

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 64444656

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 556857255.

Akr1c21 - Dent disease model: renal proximal tubules

Annotation:: Akr1c21, aldo-keto reductase family 1, member C21

Organism:: Mus musculus

Reporter:: GPL1261, 1451030_at (ID_REF), GDS3397, 77337 (Gene ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 55685725

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 414372536.

Akr1c21 - Nephronophthisis model

Annotation:: Akr1c21, aldo-keto reductase family 1, member C21

Organism:: Mus musculus

Reporter:: GPL2897, 396013 (ID_REF), GDS2817, NM_029901

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41437253

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 76785987.

Akr1c21 - X-linked hypophosphatemia and low phosphate diet

Annotation:: Akr1c21, aldo-keto reductase family 1, member C21

Organism:: Mus musculus

Reporter:: GPL81, 160733_at (ID_REF), GDS879, 77337 (Gene ID)

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 7678598

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 26314988.

Akr1c21 - Type 2 diabetes and renal function

Annotation:: Akr1c21, aldo-keto reductase family 1, member C21

Organism:: Mus musculus

Reporter:: GPL81, 160733_at (ID_REF), GDS402, 77337 (Gene ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 2631498

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1128753709.

Akr1c21 - Renal tubular von Hippel-Lindau protein preconditional knockout effect on rhabdomyolysis-induced AKI kidney

Annotation:: Akr1c21, aldo-keto reductase family 1, member C21

Organism:: Mus musculus

Reporter:: GPL6246, 10403333 (ID_REF), GDS4864, NM_029901, AB178898, AY742217, BC013531, BC061057, BC091761, chr13:4574075-4586543 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 112875370

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9120822510.

Akr1c21 - Transgenic model Tg26 of HIV-Associated Nephropathy: kidney cortex

Annotation:: Akr1c21, aldo-keto reductase family 1, member C21

Organism:: Mus musculus

Reporter:: GPL1261, 1451030_at (ID_REF), GDS4234, 77337 (Gene ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 91208225

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7524472511.

Akr1c21 - Uninephrectomy effect on OVE26 diabetic kidney

Annotation:: Akr1c21, aldo-keto reductase family 1, member C21

Organism:: Mus musculus

Reporter:: GPL1261, 1451030_at (ID_REF), GDS3990, 77337 (Gene ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 75244725

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4988932512.

Akr1c21 - Various tissues

Annotation:: Akr1c21, aldo-keto reductase family 1, member C21

Organism:: Mus musculus

Reporter:: GPL1261, 1451030_at (ID_REF), GDS3142, 77337 (Gene ID)

DataSet type:: Expression profiling by array, count, 70 samples

ID:: 49889325

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 749798813.

Akr1c21 - MPSS transcriptome analysis project

Annotation:: Akr1c21, aldo-keto reductase family 1, member C21

Organism:: Mus musculus

Reporter:: GPL1010, GATCAAAGAGAACATGCAGG (ID_REF), GDS868, BC013531

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7497988

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 462978714.

Akr1c21 - Large-scale analysis of the mouse transcriptome (GNF1M)

Annotation:: Akr1c21, aldo-keto reductase family 1, member C21

Organism:: Mus musculus

Reporter:: GPL1073, gnf1m05523_a_at (ID_REF), GDS592, 9430025F20 (CLONE ID)

DataSet type:: Expression profiling by array, count, 122 samples

ID:: 4629787

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 437169315.

Akr1c21 - Sex specific transcription in somatic and reproductive tissues

Annotation:: Akr1c21, aldo-keto reductase family 1, member C21

Organism:: Mus musculus

Reporter:: GPL339, 1451030_at (ID_REF), GDS565, 77337 (Gene ID)

DataSet type:: Expression profiling by array, count, 48 samples

ID:: 4371693

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11938911816.

Akr1c21 - Chronic, low level drug exposure effect on obese liver

Annotation:: Akr1c21, aldo-keto reductase family 1, member C21

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P208472 (ID_REF), GDS5258, NM_029901, A_51_P208472 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119389118

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7168735417.

Akr1c21 - Fasting effect on multiple tissues: time course

Annotation:: Akr1c21, aldo-keto reductase family 1, member C21

Organism:: Mus musculus

Reporter:: GPL11012, 21854 (ID_REF), GDS3893, NM_029901

DataSet type:: Expression profiling by array, log2 ratio, 122 samples

ID:: 71687354

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5296248818.

Akr1c21 - Liver response to Pacific ciguatoxin-1: time course

Annotation:: Akr1c21, aldo-keto reductase family 1, member C21

Organism:: Mus musculus

Reporter:: GPL2872, 16088 (ID_REF), GDS3259, NM_029901, A_51_P208472 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 9 samples

ID:: 52962488

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2893069319.

Akr1c21 - Hereditary pulmonary arterial hypertension model: lung

Annotation:: Akr1c21, aldo-keto reductase family 1, member C21

Organism:: Mus musculus

Reporter:: GPL339, 1451030_at (ID_REF), GDS2248, 77337 (Gene ID)

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 28930693

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4740132520.

Akr1c21 - Various normal tissues

Annotation:: Akr1c21, aldo-keto reductase family 1, member C21

Organism:: Mus musculus

Reporter:: GPL1261, 1451030_at (ID_REF), GDS3052, 77337 (Gene ID)

DataSet type:: Expression profiling by array, count, 17 samples

ID:: 47401325

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 72

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 77337) (1421)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1421

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity