ClinVar Genomic variation as it relates to human health
NM_001077365.2(POMT1):c.1847_1865dup (p.Gly624fs)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_001077365.2(POMT1):c.1847_1865dup (p.Gly624fs)
Variation ID: 2951161 Accession: VCV002951161.1
- Type and length
-
Duplication, 19 bp
- Location
-
Cytogenetic: 9q34.13 9: 131522063-131522064 (GRCh38) [ NCBI UCSC ] 9: 134397450-134397451 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Feb 29, 2024 Feb 28, 2024 Nov 30, 2023 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_001077365.2:c.1847_1865dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_001070833.1:p.Gly624fs frameshift NM_001077366.2:c.1685_1703dup NP_001070834.1:p.Gly570fs frameshift NM_001136113.2:c.1847_1865dup NP_001129585.1:p.Gly624fs frameshift NM_001136114.2:c.1496_1514dup NP_001129586.1:p.Gly507fs frameshift NM_001353193.2:c.1913_1931dup NP_001340122.2:p.Gly646fs frameshift NM_001353194.2:c.1685_1703dup NP_001340123.1:p.Gly570fs frameshift NM_001353195.2:c.1496_1514dup NP_001340124.1:p.Gly507fs frameshift NM_001353196.2:c.1757_1775dup NP_001340125.1:p.Gly594fs frameshift NM_001353197.2:c.1751_1769dup NP_001340126.2:p.Gly592fs frameshift NM_001353198.2:c.1751_1769dup NP_001340127.2:p.Gly592fs frameshift NM_001353199.2:c.1562_1580dup NP_001340128.2:p.Gly529fs frameshift NM_001353200.2:c.1391_1409dup NP_001340129.1:p.Gly472fs frameshift NM_001374689.1:c.1835_1853dup NP_001361618.1:p.Gly620fs frameshift NM_001374690.1:c.1628_1646dup NP_001361619.1:p.Gly551fs frameshift NM_001374691.1:c.1496_1514dup NP_001361620.1:p.Gly507fs frameshift NM_001374692.1:c.1496_1514dup NP_001361621.1:p.Gly507fs frameshift NM_001374693.1:c.1496_1514dup NP_001361622.1:p.Gly507fs frameshift NM_001374695.1:c.1457_1475dup NP_001361624.1:p.Gly494fs frameshift NM_001411024.1:c.716_734dup NP_001397953.1:p.Gly247fs frameshift NM_007171.4:c.1913_1931dup NP_009102.4:p.Gly646fs frameshift NR_148391.2:n.1881_1899dup non-coding transcript variant NR_148392.2:n.2099_2117dup non-coding transcript variant NR_148393.2:n.2020_2038dup non-coding transcript variant NR_148394.2:n.1774_1792dup non-coding transcript variant NR_148395.2:n.2172_2190dup non-coding transcript variant NR_148396.2:n.1806_1824dup non-coding transcript variant NR_148397.2:n.1931_1949dup non-coding transcript variant NR_148398.2:n.1886_1904dup non-coding transcript variant NR_148399.2:n.2412_2430dup non-coding transcript variant NR_148400.2:n.2011_2029dup non-coding transcript variant NC_000009.12:g.131522068_131522086dup NC_000009.11:g.134397455_134397473dup NG_008896.2:g.24167_24185dup LRG_842:g.24167_24185dup LRG_842t1:c.1913_1931dup LRG_842p1:p.Gly646fs LRG_842t2:c.1847_1865dup LRG_842p2:p.Gly624fs - Protein change
- G529fs, G551fs, G592fs, G594fs, G620fs, G472fs, G507fs, G570fs, G624fs, G247fs, G494fs, G646fs
- Other names
- -
- Canonical SPDI
- NC_000009.12:131522063:GTGCTGGCTGGGGCGCTGTGTGC:GTGCTGGCTGGGGCGCTGTGTGCTGGCTGGGGCGCTGTGTGC
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
POMT1 | - | - |
GRCh38 GRCh37 |
1142 | 1181 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (1) |
criteria provided, single submitter
|
Nov 30, 2023 | RCV003802423.1 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Nov 30, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Muscular dystrophy-dystroglycanopathy (congenital with intellectual disability), type B1
Walker-Warburg congenital muscular dystrophy Autosomal recessive limb-girdle muscular dystrophy type 2K
Explanation for multiple conditions: Uncertain.
The variant was classified for several related diseases, possibly a spectrum of disease; the variant may be associated with one or more the diseases.
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV004609020.1
First in ClinVar: Feb 28, 2024 Last updated: Feb 28, 2024 |
Comment:
This sequence change creates a premature translational stop signal (p.Gly646Trpfs*91) in the POMT1 gene. While this is not anticipated to result in nonsense mediated decay, … (more)
This sequence change creates a premature translational stop signal (p.Gly646Trpfs*91) in the POMT1 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 102 amino acid(s) of the POMT1 protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with POMT1-related conditions. This variant disrupts a region of the POMT1 protein in which other variant(s) (p.Asp723Glyfs*8) have been determined to be pathogenic (PMID: 12369018, 16575835, 17559086, 22323514, 24304607, 24491487). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
A novel missense mutation in POMT1 modulates the severe congenital muscular dystrophy phenotype associated with POMT1 nonsense mutations. | Wallace SE | Neuromuscular disorders : NMD | 2014 | PMID: 24491487 |
Detection limit of intragenic deletions with targeted array comparative genomic hybridization. | Askree SH | BMC genetics | 2013 | PMID: 24304607 |
Cobblestone lissencephaly: neuropathological subtypes and correlations with genes of dystroglycanopathies. | Devisme L | Brain : a journal of neurology | 2012 | PMID: 22323514 |
Molecular heterogeneity in fetal forms of type II lissencephaly. | Bouchet C | Human mutation | 2007 | PMID: 17559086 |
The expanding phenotype of POMT1 mutations: from Walker-Warburg syndrome to congenital muscular dystrophy, microcephaly, and mental retardation. | van Reeuwijk J | Human mutation | 2006 | PMID: 16575835 |
Mutations in the O-mannosyltransferase gene POMT1 give rise to the severe neuronal migration disorder Walker-Warburg syndrome. | Beltrán-Valero de Bernabé D | American journal of human genetics | 2002 | PMID: 12369018 |
Text-mined citations for this variant ...
HelpRecord last updated Mar 30, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.