GEO Profiles Links for Nucleotide (Select 262205327) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 493

<< First< Prev

Page of 25

Next >Last >>

Select item 756547761.

Dgkz - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Dgkz, diacylglycerol kinase zeta

Organism:: Mus musculus

Reporter:: GPL6481, 6400129 (ID_REF), GDS4002, NM_138306, Dgkz (ORF)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75654776

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 677322602.

Dgkz - IKKbeta deletion effect on neutrophils

Annotation:: Dgkz, diacylglycerol kinase zeta

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2915059 (ID_REF), GDS3776, NM_138306

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 67732260

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 249455203.

Dgkz - Estren effect on the estrogen receptor alpha null uterus: time course

Annotation:: Dgkz, diacylglycerol kinase zeta

Organism:: Mus musculus

Reporter:: GPL891, 120 (ID_REF), GDS2078, NM_138306, A_51_P226049 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 10 samples

ID:: 24945520

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74720524.

Dgkz - MPSS transcriptome analysis project

Annotation:: Dgkz, diacylglycerol kinase zeta

Organism:: Mus musculus

Reporter:: GPL1010, GATCCACCCACCCTGGGCAT (ID_REF), GDS868, NM_138306

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7472052

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1032924125.

Dgkz - MEKK2 and MEKK3 deficiency effect on CD26L(low)CD44(high) CD4 T cells

Annotation:: Dgkz, diacylglycerol kinase zeta

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2915059 (ID_REF), GDS4795, NM_138306, DGKZ (ORF)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 103292412

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 719316606.

Dgkz - Fear conditioning effect on hybrid mouse diversity panel: hippocampus and striatum

Annotation:: Dgkz, diacylglycerol kinase zeta

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2915059 (ID_REF), GDS3900, NM_138306

DataSet type:: Expression profiling by array, count, 198 samples

ID:: 71931660

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1032924107.

Dgkz - MEKK2 and MEKK3 deficiency effect on CD26L(low)CD44(high) CD4 T cells

Annotation:: Dgkz, diacylglycerol kinase zeta

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2915060 (ID_REF), GDS4795, NM_138306, DGKZ (ORF)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 103292410

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 677322618.

Dgkz - IKKbeta deletion effect on neutrophils

Annotation:: Dgkz, diacylglycerol kinase zeta

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2915060 (ID_REF), GDS3776, NM_138306

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 67732261

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1257275609.

Dgkz - Receptor activator of NF-κB ligand effect on bone marrow-derived macrophage cells: time course

Annotation:: Dgkz, diacylglycerol kinase zeta

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2915059 (ID_REF), GDS5422, NM_138306

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125727560

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12131276110.

Dgkz - Restless Legs Syndrome model: adult whole brain

Annotation:: Dgkz, diacylglycerol kinase zeta

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2915060 (ID_REF), GDS5299, NM_138306

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 121312761

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9683415211.

Dgkz - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: Dgkz, diacylglycerol kinase zeta

Organism:: Mus musculus

Reporter:: GPL6246, 10485081 (ID_REF), GDS4486, NM_001166597, NM_138306, XM_006498539, XM_006498540, AK170936, BC014860, BC049228, chr2:91932826-91975778 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96834152

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7874116012.

Dgkz - Human Epidermal Growth Factor Receptor 2-positive breast cancer MMTV-Her2/Neu murine model: primary and secondary mammary tumors

Annotation:: Dgkz, diacylglycerol kinase zeta

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2915059 (ID_REF), GDS4099, NM_138306

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 78741160

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12131276013.

Dgkz - Restless Legs Syndrome model: adult whole brain

Annotation:: Dgkz, diacylglycerol kinase zeta

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2915059 (ID_REF), GDS5299, NM_138306

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 121312760

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10329241114.

Dgkz - MEKK2 and MEKK3 deficiency effect on CD26L(low)CD44(high) CD4 T cells

Annotation:: Dgkz, diacylglycerol kinase zeta

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1239607 (ID_REF), GDS4795, NM_138306, DGKZ (ORF)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 103292411

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7510325215.

Dgkz - Segmented filamentous bacteria gut colonization effect on nonobese diabetic mice: T cells

Annotation:: Dgkz, diacylglycerol kinase zeta

Organism:: Mus musculus

Reporter:: GPL6246, 10485081 (ID_REF), GDS3987, NM_001166597, NM_138306, XM_006498539, XM_006498540, AK170936, BC014860, BC049228, chr2:91932826-91975778 (SPOT ID)

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 75103252

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6161931216.

Dgkz - PTEN heterozygosity effect on Smoothened-active mouse model

Annotation:: Dgkz, diacylglycerol kinase zeta

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2915059 (ID_REF), GDS3582, NM_138306, DGKZ (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 61619312

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2492222017.

Dgkz - Estren effect on the uterus: time course

Annotation:: Dgkz, diacylglycerol kinase zeta

Organism:: Mus musculus

Reporter:: GPL891, 120 (ID_REF), GDS2077, NM_138306, A_51_P226049 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 12 samples

ID:: 24922220

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12572756118.

Dgkz - Receptor activator of NF-κB ligand effect on bone marrow-derived macrophage cells: time course

Annotation:: Dgkz, diacylglycerol kinase zeta

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2915060 (ID_REF), GDS5422, NM_138306

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 125727561

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12334581119.

Dgkz - Casein kinase 1 α deficiency effect on leukemia stem cells

Annotation:: Dgkz, diacylglycerol kinase zeta

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_1239607 (ID_REF), GDS5360, NM_138306, DGKZ (ORF)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 123345811

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11593701220.

Dgkz - Auditory fear conditioning effect on amygdala: time course

Annotation:: Dgkz, diacylglycerol kinase zeta

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2915059 (ID_REF), GDS5157, NM_138306, DGKZ (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 115937012

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 25

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 262205327) (493)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 493

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity