NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL6885 Query DataSets for GPL6885
Status Public on May 21, 2008
Title Illumina MouseRef-8 v2.0 expression beadchip
Technology type oligonucleotide beads
Distribution commercial
Organism Mus musculus
Manufacturer Illumina Inc.
Manufacture protocol see manufacturer's website
 
Description The MouseRef-8 v2.0 Expression BeadChip offer the most up-to-date content for whole-genome expression profiling in the mouse. Featuring content derived from the National Center for Biotechnology Information Reference Sequence (NCBI RefSeq) database (Build 36, Release 22).

Please use the GEO Data Submission Report Plug-in v1.0 for Gene Expression which may be downloaded from https://icom.illumina.com/icom/software.ilmn?id=234 to format the normalized and raw data. These should be submitted as part of a GEOarchive. Instructions for assembling a GEOarchive may be found at http://www.ncbi.nlm.nih.gov/projects/geo/info/spreadsheet.html
 
Submission date May 21, 2008
Last update date Jun 14, 2018
Organization Illumina Inc.
E-mail expression@illumina.com, techsupport@illumina.com
Phone 1 800 809 4566
URL http://www.illumina.com
Street address 9885 Towne Centre Drive
City San Diego
State/province CA
ZIP/Postal code 92121
Country USA
 
Samples (15705) GSM326633, GSM326634, GSM326635, GSM326636, GSM326637, GSM326638 
Series (831)
GSE13040 E11.5 Mouse Endodermal Organ Gene Expression
GSE13974 Genetic inactivation of serine racemase produces behavioral phenotypes related to schizophrenia in mice
GSE15354 Cardiac left ventricles of 12 week-old male C57BL/6J and C57BL/6J-chrY<A/J/NaJ> mice

Data table header descriptions
ID Unique identifier for the probe (across all products and species)
Species
Source Transcript sequence source name
Search_Key Internal id useful for custom design array
Transcript Internal transcript id
ILMN_Gene Internal gene symbol
Source_Reference_ID Id in the source database
RefSeq_ID Refseq id
Entrez_Gene_ID Entrez gene id
GI Genbank id
Accession Genbank accession number
Symbol Gene symbol from the source database
Protein_Product Genbank protein accession number
Array_Address_Id Decoder id
Probe_Type Information about what this probe is targeting
Probe_Start Position of the probe relative to the 5' of the source transcript sequence
SEQUENCE Probe sequence
Chromosome Chromosome
Probe_Chr_Orientation Orientation on the NCBI genome built
Probe_Coordinates genomic position of the probe on the NCBI genome built
Cytoband
Definition Gene description from the source
Ontology_Component Cellular component annotations from Gene Ontology project
Ontology_Process Biological process annotations from Gene Ontology project
Ontology_Function Molecular function annotations from Gene Ontology project
Synonyms Gene symbol synonyms from Refseq
Obsolete_Probe_Id Identifier of probe id before bgx time
GB_ACC

Data table
ID Species Source Search_Key Transcript ILMN_Gene Source_Reference_ID RefSeq_ID Entrez_Gene_ID GI Accession Symbol Protein_Product Array_Address_Id Probe_Type Probe_Start SEQUENCE Chromosome Probe_Chr_Orientation Probe_Coordinates Cytoband Definition Ontology_Component Ontology_Process Ontology_Function Synonyms Obsolete_Probe_Id GB_ACC
ILMN_2659724 Mus musculus RefSeq ILMN_215452 ILMN_215452 GPR135 NM_181752.1 NM_181752.1 238252 32306523 NM_181752.1 Gpr135 NP_861417.1 1030692 S 1292 CTTCTTCCGAGAGGGTCCACCGGACTCAGTTATGGAAGTCGGCAAACTGC 12 - 73170637-73170686 12qC3 Mus musculus G protein-coupled receptor 135 (Gpr135), mRNA. integral to membrane [goid 16021] [evidence IEA]; membrane [goid 16020] [evidence IEA] G-protein coupled receptor protein signaling pathway [goid 7186] [evidence IEA]; signal transduction [goid 7165] [evidence IEA] receptor activity [goid 4872] [evidence IEA]; signal transducer activity [goid 4871] [evidence IEA]; rhodopsin-like receptor activity [goid 1584] [evidence IEA]; G-protein coupled receptor activity [goid 4930] [evidence IEA] PAFR scl00238252.1_311-S-5 NM_181752.1
ILMN_2706226 Mus musculus RefSeq ILMN_201563 ILMN_201563 OLFR811 NM_146552.1 NM_146552.1 258545 33239341 NM_146552.1 Olfr811 NP_666763.1 4180338 S 595 CTTTAGCTGTTATGACACTTGTGATCACCTTGATCTTAGTGATTCTCTCC 10 - 129238935-129238984 10qD3 Mus musculus olfactory receptor 811 (Olfr811), mRNA. integral to membrane [goid 16021] [evidence ISS]; membrane [goid 16020] [evidence IEA] G-protein coupled receptor protein signaling pathway [goid 7186] [evidence ISS]; signal transduction [goid 7165] [evidence IEA] olfactory receptor activity [goid 4984] [evidence ISS]; receptor activity [goid 4872] [evidence IEA]; signal transducer activity [goid 4871] [evidence IEA]; G-protein coupled receptor activity [goid 4930] [evidence IEA] MOR110-6 scl0258545.1_17-S-6 NM_146552.1
ILMN_1217123 Mus musculus RefSeq ILMN_195313 ILMN_195313 ZFPN1A2 NM_011770.2 NM_011770.2 22779 31544068 NM_011770.2 Zfpn1a2 NP_035900.2 4560541 S 1 CAGTGTTCTGTCCACAGTCCATTCCTCTTTGACTCTTGGAATAGAAGGTC 1 - 69618979-69619028 1qC3 Mus musculus IKAROS family zinc finger 2 (Ikzf2), mRNA. intracellular [goid 5622] [evidence IEA]; nucleus [goid 5634] [evidence IEA]; transcription factor complex [goid 5667] [evidence IEA] regulation of transcription, DNA-dependent [goid 6355] [evidence IEA]; transcription [goid 6350] [evidence IEA] nucleic acid binding [goid 3676] [evidence IEA]; metal ion binding [goid 46872] [evidence IEA]; zinc ion binding [goid 8270] [evidence IEA]; DNA binding [goid 3677] [evidence IEA]; transcription factor activity [goid 3700] [evidence IEA] Zfpn1a2; Helios; Znfn1a2 scl022779.1_70-S-1 NM_011770.2
ILMN_2780205 Mus musculus RefSeq ILMN_213176 ILMN_213176 CTNNA1 NM_009818.1 NM_009818.1 12385 6753293 NM_009818.1 Ctnna1 NP_033948.1 70753 S 3452 CACCATCGGGCTCATTTCTAATCGTCGCAGTGTTTCCTGCTTTGGGCCAG 18 + 35414205-35414254 18qB1 Mus musculus catenin (cadherin associated protein), alpha 1 (Ctnna1), mRNA. lamellipodium [goid 30027] [evidence IDA]; cytoskeleton [goid 5856] [evidence IEA]; adherens junction [goid 5912] [evidence IDA]; actin cytoskeleton [goid 15629] [evidence IEA]; zonula adherens [goid 5915] [evidence IDA] cell adhesion [goid 7155] [evidence IEA] actin filament binding [goid 51015] [evidence IDA]; structural molecule activity [goid 5198] [evidence IEA]; cadherin binding [goid 45296] [evidence IEA]; protein binding [goid 5515] [evidence IPI] 2010010M04Rik; AA517462; AI988031; Catna1 NM_009818.1
ILMN_2713160 Mus musculus RefSeq ILMN_219747 ILMN_219747 RTCD1 NM_025517.1 NM_025517.1 66368 21313509 NM_025517.1 Rtcd1 NP_079793.1 5340730 S 1403 TGAACGATCAAACGTAATGAATATGTGTAATAGTCAACTTCAATATTAAC 3 - 116481010-116481059 3qG1 Mus musculus RNA terminal phosphate cyclase domain 1 (Rtcd1), mRNA. nucleus [goid 5634] [evidence IEA] RNA processing [goid 6396] [evidence IEA] ligase activity [goid 16874] [evidence IEA]; RNA-3'-phosphate cyclase activity [goid 3963] [evidence IEA] 2310009A18Rik; RPC; AI450277; MGC102342 scl21611.11.1_4-S-7 NM_025517.1
ILMN_2650094 Mus musculus RefSeq ILMN_214629 ILMN_214629 KRTAP12-1 NM_010670.1 NM_010670.1 16694 6754489 NM_010670.1 Krtap12-1 NP_034800.1 6180647 S 517 CACCAGGTGGGAACCCTACCTGTCCCACCCCGAACCTTGAAGAACAGATT 10 + 77183847-77183896 10qC1 Mus musculus keratin associated protein 12-1 (Krtap12-1), mRNA. keratin filament [goid 45095] [evidence IEA]; intermediate filament [goid 5882] [evidence IEA] MGC130277; D10Jhu14e; MGC130278; AI507309; AI586068 scl5756.1.1_227-S-2 NM_010670.1
ILMN_2703479 Mus musculus RefSeq ILMN_219043 ILMN_219043 CYP3A16 NM_007820.1 NM_007820.1 13114 6681116 NM_007820.1 Cyp3a16 NP_031846.1 3890193 S 1610 AGTCTAAGAACATTGAACACTTTAGTCTCATCATGAATAAAAATCAAGAT 5 - 146197219-146197268 5qG2 Mus musculus cytochrome P450, family 3, subfamily a, polypeptide 16 (Cyp3a16), mRNA. membrane [goid 16020] [evidence IEA]; endoplasmic reticulum [goid 5783] [evidence IEA]; microsome [goid 5792] [evidence IEA] electron transport [goid 6118] [evidence IEA] oxidoreductase activity [goid 16491] [evidence IEA]; heme binding [goid 20037] [evidence IEA]; metal ion binding [goid 46872] [evidence IEA]; unspecific monooxygenase activity [goid 50381] [evidence IEA]; iron ion binding [goid 5506] [evidence IEA]; monooxygenase activity [goid 4497] [evidence IEA]; oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [goid 16712] [evidence IEA] MGC130513 scl25781.13.1_128-S-10 NM_007820.1
ILMN_2952493 Mus musculus RefSeq ILMN_231577 ILMN_231577 LOC433722 NM_001081647.1 NM_001081647.1 433722 126032324 NM_001081647.1 LOC433722 NP_001075116.1 2810497 S 535 GGGCACGGTAACCCACCAGCTTCCTATGCACCTTCCCTCTGCATTGATGG 4 + 73316231-73316280 Mus musculus similar to hypothetical protein 4930503F14 (LOC433722), mRNA. NM_001081647.1
ILMN_2731592 Mus musculus RefSeq ILMN_221150 ILMN_221150 2610019A05RIK NM_028126.1 NM_028126.1 72149 21312399 NM_028126.1 2610019A05Rik NP_082402.1 7150360 S 1425 CAAGCTGGCTGTTGGCTACTTGAAAGGACATTCTAGAAGGGACTTCACTG 11 - 105979966-105980015 11qE1 Mus musculus RIKEN cDNA 2610019A05 gene (2610019A05Rik), mRNA. protein amino acid phosphorylation [goid 6468] [evidence IEA] nucleotide binding [goid 166] [evidence IEA]; protein serine/threonine kinase activity [goid 4674] [evidence IEA]; transferase activity [goid 16740] [evidence IEA]; ATP binding [goid 5524] [evidence IEA]; kinase activity [goid 16301] [evidence IEA] AI480680; 6030402H20Rik; E130112C09Rik scl072149.1_20-S-2 NM_028126.1
ILMN_2729743 Mus musculus MEEBO ILMN_185811 ILMN_185811 1810073N04RIK scl40645.2_300 31541851 NM_024249 1810073N04Rik 7550356 S 4426 GGTCCTGTTTGGACCAGGCCATGCCCTAGTTAGTGTGCACGTTCTGCACC scl39249.20_276-S-10 NM_024249
ILMN_1252621 Mus musculus RefSeq ILMN_218845 ILMN_218845 2700050P07RIK NM_133927.1 NM_133927.1 101142 19527141 NM_133927.1 2700050P07Rik NP_598688.1 1980164 S 2031 CTGCCATTCAGCTGTATCCAGCACTGCCGTTCTCTAAAGTACCGTGCTGC 6 - 128359680-128359729 6qF3 Mus musculus integrin alpha FG-GAP repeat containing 2 (Itfg2), mRNA. integrin-mediated signaling pathway [goid 7229] [evidence IEA] transferase activity [goid 16740] [evidence IEA] AI646725; 2700050P07Rik scl28357.13.1_35-S-1 NM_133927.1
ILMN_3162407 Mus musculus MEEBO ILMN_188430 ILMN_188430 ZFP36 scl022695.1_83 NM_011756.3 34787413 NM_011756.3 Zfp36 6220026 S 1512 GCAAATAGCCAAAGCCATTGCCAAATCCCTTCTCCCCCAACCAGTGGGCC GI_34787413-S-1 NM_011756.3
ILMN_2692952 Mus musculus RefSeq ILMN_218208 ILMN_218208 4833436C18RIK NM_177377.2 NM_177377.2 329831 31340791 NM_177377.2 4833436C18Rik NP_796351.1 6040743 S 1249 GTGGGTCGGGGAGGGGCACAAAGAAAATGGCTTGGAGGCTGAGCACCTTT 4 - 43448169-43448218 4qA5 Mus musculus RIKEN cDNA 4833436C18 gene (4833436C18Rik), mRNA. scl0329831.1_281-S-4 NM_177377.2
ILMN_2910076 Mus musculus RefSeq ILMN_242789 ILMN_242789 BC051665 NM_199148.1 NM_199148.1 218275 40255290 NM_199148.1 BC051665 NP_954599.1 1710364 S 1024 AACTGTGGGATTGCTACCTATGCCATCTACCCCACCGTGTGAGCTGCCCG 13 - 60883507-60883515:60883516-60883556 13qB2 Mus musculus cDNA sequence BC051665 (BC051665), mRNA. cysteine-type peptidase activity [goid 8234] [evidence IEA]; hydrolase activity [goid 16787] [evidence IEA]; peptidase activity [goid 8233] [evidence IEA]; cysteine-type endopeptidase activity [goid 4197] [evidence IEA] MGC60730 NM_199148.1
ILMN_2709047 Mus musculus MEEBO ILMN_189434 ILMN_189434 PAF53 scl25476.15.1_91 12328815 NM_022811 Paf53 3780132 S 1471 GGACTCCATCATGCTCCACCACACCCCCGAGGCCTTACTTTAGGGTGGTT scl0064424.2_263-S-5 NM_022811
ILMN_2718462 Mus musculus MEEBO ILMN_220168 ILMN_220168 0610009J22RIK scl41892.7.15_25 NM_027859.1 21313663 NM_027859.1 0610009J22Rik 4810279 S 1122 GAGACTGTGTGGACCCCTGGCTGATGCTACAACAGACCTGCCCACTGTGC scl41892.7.15_25-S-5 NM_027859.1
ILMN_2882078 Mus musculus RefSeq ILMN_214014 ILMN_214014 PHF13 NM_172705.1 NM_172705.1 230936 29789396 NM_172705.1 Phf13 NP_766293.1 7380500 S 2436 TGCAAACTGGGCGTGAGCCTCTCTGGGCTCCTGGTTGATGGCTAATGCTG 4 - 151363896-151363945 4qE2 Mus musculus PHD finger protein 13 (Phf13), mRNA. regulation of transcription, DNA-dependent [goid 6355] [evidence IEA]; regulation of transcription, DNA-dependent [goid 6355] [evidence IEA] zinc ion binding [goid 8270] [evidence IEA]; metal ion binding [goid 46872] [evidence IEA]; protein binding [goid 5515] [evidence IEA]; zinc ion binding [goid 8270] [evidence IEA]; metal ion binding [goid 46872] [evidence IEA]; protein binding [goid 5515] [evidence IEA] BC029632; Phf5 NM_172705.1
ILMN_2882079 Mus musculus RefSeq ILMN_214014 ILMN_214014 PHF13 NM_172705.1 NM_172705.1 230936 29789396 NM_172705.1 Phf13 NP_766293.1 130070 S 2369 GTGTCAGAATTTGGACACCTTGGTTTGGGGGTAGGTTGAGCTGGGCCAGC 4 - 151363963-151364012 4qE2 Mus musculus PHD finger protein 13 (Phf13), mRNA. regulation of transcription, DNA-dependent [goid 6355] [evidence IEA]; regulation of transcription, DNA-dependent [goid 6355] [evidence IEA] zinc ion binding [goid 8270] [evidence IEA]; metal ion binding [goid 46872] [evidence IEA]; protein binding [goid 5515] [evidence IEA]; zinc ion binding [goid 8270] [evidence IEA]; metal ion binding [goid 46872] [evidence IEA]; protein binding [goid 5515] [evidence IEA] BC029632; Phf5 NM_172705.1
ILMN_2771368 Mus musculus MEEBO ILMN_211818 ILMN_211818 ACOX1 scl0001508.1_4 NM_015729.1 7656854 NM_015729.1 Acox1 5090039 S 3437 GGCTAGTTGGAACTCTTTGTTCTTAAAAGCACAGTAGAGAGATCATTGTG scl011430.3_98-S-1 NM_015729.1
ILMN_2724039 Mus musculus RefSeq ILMN_220581 ILMN_220581 HOXA6 NM_010454.1 NM_010454.1 15403 27544942 NM_010454.1 Hoxa6 NP_034584.1 3850343 S 637 ATAAACTCATCAACTCCACGCAGGCCAGCGGGGAAGACTCTGAGGCCAAA 6 - 52156376-52156425 6qB3 Mus musculus homeo box A6 (Hoxa6), mRNA. transcription factor complex [goid 5667] [evidence IEA]; nucleus [goid 5634] [evidence IEA] transcription [goid 6350] [evidence IEA]; regulation of transcription [goid 45449] [evidence IEA]; pattern specification [goid 7389] [evidence IEA]; regulation of transcription, DNA-dependent [goid 6355] [evidence IEA]; development [goid 7275] [evidence IEA] sequence-specific DNA binding [goid 43565] [evidence IEA]; transcription factor activity [goid 3700] [evidence IEA]; DNA binding [goid 3677] [evidence IEA] Hox-1.2 scl29007.2.1_179-S-6 NM_010454.1

Total number of rows: 25697

Table truncated, full table size 15975 Kbytes.






Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary file Size Download File type/resource
GPL6885_MouseRef-8_V2_0_R0_11278551_A.bgx.gz 3.1 Mb (ftp)(http) BGX

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap