Alignment last updated: 01/30/2014 22:05:30
Alignment for BX248090.12 and CR392368.7
Download Genome Workbench
Swap Rows Rotate Orientations
Swap Rows Rotate Orientations
BX248090.12 Zebrafish DNA sequence from clone DKEY-156K12 in linkage group 20, complete sequence [htgs_phase3]
Length: 197,908 bp
CR392368.7 Zebrafish DNA sequence from clone DKEY-86E18 in linkage group 20, complete sequence [htgs_phase3]
Length: 87,973 bp
Alignment Summary
Join evaluation: Alignment count: 1
|
Type | Point1 | Point2 | Orient1 | Orient2 | Curator | Comment | Time | Id | Alignment | Releases |
A | 197908 | 85973 | + | - | chenhc | Taxid 7955 chrom 20 Primary assembly | 2014-01-30 22:05:30.296 | 114372 | 119341 | GRCz11, GRCz10 |
Alignment 1 of 1
BX248090.12 : + : 195909..197908 CR392368.7 : - : 87973..85974 Mismatches = 0, Gaps = 0, Length = 2000 Percent identity = 100% Score = 3694 bits (2000), Expect = 0 15 BAC and 11 Fosmid bridging clones. 15 BAC and 11 Fosmid concordant clones. 0 BAC and 0 Fosmid discordant clones. BX248090.12 >195909 gcaggcctttcacaggctctggcctcaactgggttatgctccactttgataacatccctg 195968 CR392368.7 <87973 ............................................................ 87914 BX248090.12 >195969 gcttacaataagatcattctgcaggctgggctttgacagaaaacagcactctgactttgg 196028 CR392368.7 <87913 ............................................................ 87854 BX248090.12 >196029 ctacttcaagcggtttgatgtttttctctgtacaagggcacagtttactacaacactggg 196088 CR392368.7 <87853 ............................................................ 87794 BX248090.12 >196089 actttccacactgcaacccactaaaggcccagaggttttggatgctaggctagttctcac 196148 CR392368.7 <87793 ............................................................ 87734 BX248090.12 >196149 acacagaaacatcacatcacagtccattttcacctacacgaaggtgtaaaaacacacatg 196208 CR392368.7 <87733 ............................................................ 87674 BX248090.12 >196209 catgcaaacaagcaaacgcaacagagagatggctgggaaattcaattttgctttttaaat 196268 CR392368.7 <87673 ............................................................ 87614 BX248090.12 >196269 gtagtttcacttgtgaccctggatcacaaaatctgttttgaattcaaaactagtgtgggt 196328 CR392368.7 <87613 ............................................................ 87554 BX248090.12 >196329 ttattggtggggaaagccaaaaaagtcaaaactatatatatttacattttttaatttttt 196388 CR392368.7 <87553 ............................................................ 87494 BX248090.12 >196389 ttttacaaaatattcagaatattaacgtaacacttgttgtacaagccccctagagttaaa 196448 CR392368.7 <87493 ............................................................ 87434 BX248090.12 >196449 ccagatatttacattagatgttgcctacgatattgttgtttattggaaggaatgggtcaa 196508 CR392368.7 <87433 ............................................................ 87374 BX248090.12 >196509 tagagctgccattttggtacagggtagcgcccctttgaaatgaatgagggagcaaggtgc 196568 CR392368.7 <87373 ............................................................ 87314 BX248090.12 >196569 agtggaggactggccatccatatatatgatcaggagttttcccggtggtcagtatgcact 196628 CR392368.7 <87313 ............................................................ 87254 BX248090.12 >196629 tttttatatcgatggatctgttatcgcatgggtagggccagacggaatctgcggacgttt 196688 CR392368.7 <87253 ............................................................ 87194 BX248090.12 >196689 tttgctatttctgctgagaattttggtaaaaatctgcagatttctgtggaattattttgg 196748 CR392368.7 <87193 ............................................................ 87134 BX248090.12 >196749 gagcatcataactaaaacccaaatatatgaaataaaaaataatattattttaacttttat 196808 CR392368.7 <87133 ............................................................ 87074 BX248090.12 >196809 ttaatgtttaaaatgcaaatccatttagattcactttatttggtaaacgaagcaaagcat 196868 CR392368.7 <87073 ............................................................ 87014 BX248090.12 >196869 atacgtaatatctctactaaaaaatattgctttacaaactgcattgtacataaattagat 196928 CR392368.7 <87013 ............................................................ 86954 BX248090.12 >196929 gaacattttcacattaatcaataatattactgtaattaatttaaaaactaaataaatgat 196988 CR392368.7 <86953 ............................................................ 86894 BX248090.12 >196989 gggctaaaaatctgctgaaatcagtggtaaatctgcgaaattctgcgtgcgcagatttcg 197048 CR392368.7 <86893 ............................................................ 86834 BX248090.12 >197049 tgtgggcctacgcatgggcttgcatgggaagagcgtgtgtttgagtgcatggaaatgtat 197108 CR392368.7 <86833 ............................................................ 86774 BX248090.12 >197109 taaccatcctcccttgatctaatccatgtcctgaaacacacccccgctcttgctttcacg 197168 CR392368.7 <86773 ............................................................ 86714 BX248090.12 >197169 tttcattctaccggaggacacgattagtttgtgaatgaatttccattatgaacgactctc 197228 CR392368.7 <86713 ............................................................ 86654 BX248090.12 >197229 cattatgaatgactaaaaactcaactatttagtctccacttcacttcctaatctgcaatt 197288 CR392368.7 <86653 ............................................................ 86594 BX248090.12 >197289 tcctctctgaatatagcactaactgtgtttaaaaaaaaaaaaaaaaaaaaattactactg 197348 CR392368.7 <86593 ............................................................ 86534 BX248090.12 >197349 ctttccttcttagactttacagagctttggataaaagtgtctgctaaatgactaaatgta 197408 CR392368.7 <86533 ............................................................ 86474 BX248090.12 >197409 aatgactaaatgtgtgaaccatcaatacccctgtgtctcaacgtgtacctttctgatcta 197468 CR392368.7 <86473 ............................................................ 86414 BX248090.12 >197469 aatggtataacatttgtagtattcactaatttatggtggacagtatgcacactgaggcac 197528 CR392368.7 <86413 ............................................................ 86354 BX248090.12 >197529 aggcactgttatgttgtcaggcactcttataagttacttcaaaaactagccgttgcttca 197588 CR392368.7 <86353 ............................................................ 86294 BX248090.12 >197589 cttagccgacaataatacaagtttctggcactgcagcatcttggagatatttcatttaca 197648 CR392368.7 <86293 ............................................................ 86234 BX248090.12 >197649 ttgttttcttaatttatttaccaaaactagcataagcctatagaatttagtgcaagttgg 197708 CR392368.7 <86233 ............................................................ 86174 BX248090.12 >197709 ttctactttgccttatggtcgctatgcgatatgtatatatttatagagttaaacagctga 197768 CR392368.7 <86173 ............................................................ 86114 BX248090.12 >197769 gttatatctttttgcatacatttagcagatttctgttgggtgggagcttctttagcttag 197828 CR392368.7 <86113 ............................................................ 86054 BX248090.12 >197829 cctagcataaatcattgaatcggattagaccattagcacctcgttcaaaaagagctttga 197888 CR392368.7 <86053 ............................................................ 85994 BX248090.12 >197889 taattttcttattaaagctt 197908 CR392368.7 <85993 .................... 85974
Events
Id | Type | Date | Whodid | Comment |
298443 | InitHasAlign | 01/30/2014 22:03:24 | cgi_chen | find_overlapId: find_overlap_app.cpp 404199 2013-06-20 22:08:27Z rafanovi $ built Jan 16 2014. Toolkit wrapper using /home/boukn/code/toolkit/c++/GCC442-ReleaseMT64/lib Info: Blast Including ID: 576938310 Info: Running Blast Filter: Info: CBlastAligner found 1 hits. Info: Determined ID: gi|576938310 needs Merging. Info: Merged into 0 alignments. Info: Blast Warning: Empty Query Set Info: Determined ID: gi|576938310 needs Merging. Info: Merged into 0 alignments. Info: Blast Warning: Empty Query Set Info: Determined ID: gi|576938310 needs Merging. Info: Merged into 0 alignments. Info: Best Rank: 0 in for 576938310 of 1 Info: NG returned 1 alignments f_cron_job |
298510 | CreateSwitchPt | 01/30/2014 22:05:30 | chenhc | tpf_m_BuilderId: t Toolkit wrapper version: built Dec 11 2013 using /home/boukn/code/toolkit/c++/GCC442-ReleaseMT64/lib |
BAC Ends
Clone | R | F | ||||
---|---|---|---|---|---|---|
Accession | %id | Position (strand) | Accession | %id | Position (strand) | |
CH211-107M3 | BX248090.12 | 99.62% | pos 125016 (R+) | BX248090.12 | 100% | pos 144829 (F-) |
CH211-114C2 | BX248090.12 | 100% | pos 100861 (F-) | |||
CH211-114J23 | BX248090.12 | 100% | pos 148505 (R+) | |||
CH211-120A10 | BX248090.12 | 100% | pos 174356 (R-) | BX248090.12 | 100% | pos 123 (F+) |
CH211-122O4 | BX248090.12 | 100% | pos 66391 (R+) | |||
CH211-127B20 | BX248090.12 | 100% | pos 120549 (R-) | |||
CH211-13L18 | BX248090.12 | 99.5% | pos 120878 (F-) | |||
CH211-160I21 | CR392368.7 | 100% | pos 7118 (R-) | |||
CH211-170M23 | CR392368.7 | 99.26% | pos 16817 (F-) | |||
CH211-172H10 | BX248090.12 | 99.77% | pos 120866 (R-) | |||
CH211-172N10 | BX248090.12 | 99.86% | pos 139517 (F+) | |||
CH211-178C3 | BX248090.12 | 99.84% | pos 12795 (F-) | |||
CH211-1G11 | BX248090.12 | 99.6% | pos 125038 (F+) | |||
CH211-203M1 | BX248090.12 | 100% | pos 65661 (F-) | |||
CH211-210I13 | CR392368.7 | 98.72% | pos 12131 (F-) | |||
CH211-23H20 | BX248090.12 | 100% | pos 67545 (F-) | |||
CH211-247P24 | BX248090.12 | 100% | pos 118733 (F-) | |||
CH211-253P1 | BX248090.12 | 100% | pos 14018 (R+) | BX248090.12 | 98.97% | pos 174679 (F-) |
CH211-258G15 | CR392368.7 | 100% | pos 48862 (F-) | |||
CH211-278M24 | BX248090.12 | 100% | pos 120716 (R-) | |||
CH211-51E7 | BX248090.12 | 99.68% | pos 17711 (R+) | BX248090.12 | 100% | pos 192960 (F-) |
CH211-5O7 | CR392368.7 | 99.83% | pos 11795 (F-) | |||
CH211-71N3 | BX248090.12 | 100% | pos 12956 (F-) | |||
CH211-78B23 | BX248090.12 | 100% | pos 31441 (R-) | |||
CH211-80A13 | BX248090.12 | 99.68% | pos 138892 (R-) | |||
CH211-87K17 | BX248090.12 | 100% | pos 12669 (R-) | |||
CH211-8A15 | CR392368.7 | 99.66% | pos 56632 (F+) | |||
CH211-97H7 | BX248090.12 | 99.31% | pos 145150 (F-) | |||
BX248090.12 | 99.65% | pos 145059 (F-) | ||||
CH73-100P2 | BX248090.12 | 97.16% | pos 30559 (F+) | |||
CH73-141L7 | BX248090.12 | 97.91% | pos 188154 (R+) | |||
CH73-141O9 | CR392368.7 | 98.69% | pos 24721 (R-) | |||
CH73-165I2 | BX248090.12 | 100% | pos 145498 (F+) | |||
CH73-176J6 | CR392368.7 | 98.36% | pos 34997 (R+) | BX248090.12 | 99.72% | pos 148633 (F+) |
CH73-182F19 | CR392368.7 | 98.23% | pos 34987 (R+) | BX248090.12 | 99.75% | pos 148584 (F+) |
CH73-183F19 | CR392368.7 | 98.39% | pos 34947 (R+) | BX248090.12 | 99.88% | pos 148584 (F+) |
CH73-192I19 | CR392368.7 | 98.12% | pos 24721 (R-) | |||
CH73-192J9 | BX248090.12 | 97.88% | pos 232 (F+) | |||
CH73-201H14 | BX248090.12 | 98.53% | pos 187162 (R-) | |||
CH73-203L20 | BX248090.12 | 98.83% | pos 137296 (R+) | |||
CH73-224J18 | CR392368.7 | 97.69% | pos 47872 (R+) | BX248090.12 | 99.23% | pos 145458 (F+) |
CH73-26D19 | BX248090.12 | 99.32% | pos 125132 (F+) | |||
CH73-271A12 | BX248090.12 | 99.32% | pos 153194 (R+) | CR392368.7 | 97.66% | pos 47872 (F+) |
CH73-273L17 | BX248090.12 | 98.31% | pos 138933 (R-) | BX248090.12 | 98.08% | pos 41915 (F+) |
CH73-28B20 | BX248090.12 | 97.38% | pos 118945 (F+) | |||
CH73-2L8 | BX248090.12 | 97.11% | pos 121422 (R+) | CR392368.7 | 97.6% | pos 34955 (F+) |
CH73-306G9 | BX248090.12 | 98.15% | pos 54794 (R-) | |||
CH73-310L22 | BX248090.12 | 98.84% | pos 42760 (R+) | BX248090.12 | 100% | pos 147705 (F-) |
CH73-320J23 | BX248090.12 | 97.93% | pos 120462 (R-) | |||
CH73-369G20 | BX248090.12 | 99.82% | pos 153199 (R+) | |||
CH73-39J23 | BX248090.12 | 99.16% | pos 125130 (R+) | CR392368.7 | 98.19% | pos 34947 (F+) |
CH73-40M9 | BX248090.12 | 98.7% | pos 193730 (R+) | |||
CH73-52O23 | BX248090.12 | 97.27% | pos 118943 (F+) | |||
CH73-67D12 | CR392368.7 | 98.47% | pos 34947 (R+) | BX248090.12 | 99.6% | pos 153243 (F+) |
CH73-71H20 | BX248090.12 | 99.64% | pos 145833 (R+) | |||
CH73-89K10 | BX248090.12 | 97.71% | pos 41915 (R+) | |||
DKEY-112N14 | CR392368.7 | 99.82% | pos 2676 (R-) | |||
DKEY-124G8 | CR392368.7 | 100% | pos 60213 (R+) | BX248090.12 | 100% | pos 38483 (F+) |
DKEY-149J11 | BX248090.12 | 100% | pos 61727 (F-) | |||
DKEY-156K12 | BX248090.12 | 100% | pos 197380 (R-) | |||
CR392368.7 | 100% | pos 86001 (R+) | ||||
DKEY-175L2 | BX248090.12 | 100% | pos 195340 (R-) | |||
DKEY-190M8 | CR392368.7 | 100% | pos 1226 (R+) | BX248090.12 | 100% | pos 74008 (F+) |
DKEY-199L18 | BX248090.12 | 100% | pos 126046 (R-) | |||
DKEY-204A8 | CR392368.7 | 100% | pos 60215 (R+) | |||
DKEY-224P18 | BX248090.12 | 100% | pos 129637 (F-) | |||
DKEY-226O13 | BX248090.12 | 100% | pos 62491 (R+) | |||
DKEY-231I24 | CR392368.7 | 100% | pos 1221 (R+) | |||
DKEY-238N15 | BX248090.12 | 99.86% | pos 62379 (R+) | CR392368.7 | 100% | pos 54003 (F+) |
DKEY-242M11 | BX248090.12 | 100% | pos 115020 (F-) | |||
DKEY-244E22 | CR392368.7 | 100% | pos 30 (R+) | BX248090.12 | 100% | pos 101015 (F+) |
DKEY-245N9 | BX248090.12 | 100% | pos 9920 (R+) | BX248090.12 | 99.86% | pos 173440 (F-) |
DKEY-261M17 | BX248090.12 | 100% | pos 37633 (R-) | |||
DKEY-272M9 | CR392368.7 | 100% | pos 35970 (F-) | |||
DKEY-275A12 | CR392368.7 | 100% | pos 71502 (R+) | |||
DKEY-57E9 | BX248090.12 | 100% | pos 174585 (R-) | |||
DKEY-64B24 | CR392368.7 | 100% | pos 68676 (R-) | |||
DKEY-84C18 | CR392368.7 | 100% | pos 19825 (R-) | |||
DKEY-86E18 | CR392368.7 | 100% | pos 30 (R+) | BX248090.12 | 100% | pos 127642 (F+) |
DKEY-87J9 | BX248090.12 | 100% | pos 148053 (R-) | |||
DKEY-97O15 | BX248090.12 | 100% | pos 37573 (R-) | |||
DKEYP-12G23 | BX248090.12 | 100% | pos 126729 (R+) | |||
DKEYP-14D2 | BX248090.12 | 100% | pos 189508 (R-) | |||
DKEYP-1F5 | CR392368.7 | 100% | pos 84852 (F+) | |||
DKEYP-25P1 | BX248090.12 | 100% | pos 172620 (R+) | |||
DKEYP-36I17 | BX248090.12 | 100% | pos 37981 (F-) | |||
DKEYP-3O10 | BX248090.12 | 99.8% | pos 43255 (F+) | |||
DKEYP-49D1 | BX248090.12 | 100% | pos 129611 (F-) | |||
DKEYP-75G2 | BX248090.12 | 99.8% | pos 64550 (R-) | |||
RP71-30A19 | BX248090.12 | 100% | pos 125023 (R+) | CR392368.7 | 100% | pos 17268 (F+) |
RP71-30C11 | BX248090.12 | 100% | pos 125023 (R+) | CR392368.7 | 99.83% | pos 17254 (F+) |
RP71-85E18 | BX248090.12 | 100% | pos 31089 (F-) |
Fosmid Ends
Clone | R | F | ||||
---|---|---|---|---|---|---|
Accession | %id | Position (strand) | Accession | %id | Position (strand) | |
CH1073-129J7 | BX248090.12 | 98.34% | pos 26947 (R+) | BX248090.12 | 97.83% | pos 58496 (F-) |
CH1073-140E2 | BX248090.12 | 98.59% | pos 50347 (R+) | BX248090.12 | 98.87% | pos 81453 (F-) |
CH1073-147P7 | BX248090.12 | 99.43% | pos 43082 (R-) | BX248090.12 | 98.92% | pos 12374 (F+) |
CH1073-185L21 | BX248090.12 | 99.12% | pos 74071 (F+) | |||
CH1073-194L7 | BX248090.12 | 98.85% | pos 8256 (F-) | |||
CH1073-198D15 | CR392368.7 | 99.67% | pos 57509 (F-) | |||
CH1073-210J4 | BX248090.12 | 99.11% | pos 49285 (F+) | |||
CH1073-237I11 | CR392368.7 | 99.22% | pos 57246 (F-) | |||
CH1073-239J9 | BX248090.12 | 98.19% | pos 110880 (R-) | BX248090.12 | 98.89% | pos 77916 (F+) |
CH1073-243B6 | BX248090.12 | 98.37% | pos 179252 (R+) | CR392368.7 | 97.6% | pos 70447 (F+) |
CH1073-247A3 | BX248090.12 | 99.16% | pos 179700 (R+) | |||
CH1073-257C10 | BX248090.12 | 99.11% | pos 105797 (F+) | |||
CH1073-257C12 | BX248090.12 | 100% | pos 145123 (R-) | |||
CH1073-267B10 | CR392368.7 | 98.2% | pos 38051 (F-) | |||
CH1073-310F6 | CR392368.7 | 98.44% | pos 38111 (F+) | |||
CH1073-31F13 | BX248090.12 | 99.34% | pos 192846 (R+) | CR392368.7 | 98.73% | pos 60960 (F+) |
CH1073-320J15 | BX248090.12 | 98.51% | pos 183203 (R+) | CR392368.7 | 100% | pos 63346 (F+) |
CH1073-326D3 | BX248090.12 | 97.12% | pos 108421 (R+) | BX248090.12 | 97.84% | pos 140367 (F-) |
CH1073-328G18 | CR392368.7 | 100% | pos 25836 (R+) | |||
CR392368.7 | 100% | pos 25853 (R+) | ||||
CH1073-347C12 | BX248090.12 | 99.11% | pos 83629 (R+) | |||
CH1073-372A1 | CR392368.7 | 97.06% | pos 25024 (F+) | |||
CH1073-383F6 | BX248090.12 | 100% | pos 151719 (R-) | BX248090.12 | 97.3% | pos 117037 (F+) |
CH1073-404K18 | BX248090.12 | 98.19% | pos 165278 (R-) | |||
CH1073-423P5 | BX248090.12 | 98.1% | pos 111037 (F-) | |||
CH1073-429H1 | BX248090.12 | 97.38% | pos 44732 (R+) | |||
CH1073-429H2 | BX248090.12 | 97.23% | pos 44732 (R+) | |||
CH1073-436H18 | BX248090.12 | 99.09% | pos 89422 (F-) | |||
CH1073-441C23 | BX248090.12 | 97.52% | pos 59597 (R+) | |||
CH1073-446I10 | BX248090.12 | 99.51% | pos 89422 (F-) | |||
CH1073-448I23 | CR392368.7 | 98.48% | pos 38808 (F-) | |||
CH1073-463I2 | BX248090.12 | 98.67% | pos 170720 (R+) | CR392368.7 | 97.84% | pos 71538 (F+) |
CH1073-474B1 | BX248090.12 | 98.03% | pos 44683 (R+) | |||
CH1073-497H11 | BX248090.12 | 97.29% | pos 197464 (R+) | CR392368.7 | 99.16% | pos 60075 (F+) |
CH1073-505D13 | CR392368.7 | 98.5% | pos 24721 (R-) | |||
CH1073-520D6 | CR392368.7 | 98.48% | pos 24729 (R-) | |||
CH1073-530F6 | BX248090.12 | 99.24% | pos 129173 (R-) | |||
CH1073-530H6 | CR392368.7 | 98.81% | pos 50890 (R+) | CR392368.7 | 98.02% | pos 83700 (F-) |
CH1073-547H3 | BX248090.12 | 97.85% | pos 95540 (R-) | |||
CH1073-549D11 | BX248090.12 | 98.52% | pos 108054 (F-) | |||
CH1073-551M19 | BX248090.12 | 99.56% | pos 183582 (R-) | BX248090.12 | 98.44% | pos 154468 (F+) |
CH1073-553F3 | BX248090.12 | 99.19% | pos 32692 (F-) | |||
CH1073-553M9 | CR392368.7 | 99.68% | pos 57610 (F-) | |||
CH1073-558A11 | BX248090.12 | 99.15% | pos 62951 (F+) | |||
CH1073-561N6 | BX248090.12 | 98.63% | pos 31419 (R-) | |||
CH1073-577N16 | BX248090.12 | 99.5% | pos 191482 (R-) | BX248090.12 | 97.84% | pos 162273 (F+) |
CH1073-579H3 | BX248090.12 | 98.81% | pos 31949 (R-) | |||
CH1073-580E10 | BX248090.12 | 98.83% | pos 22802 (R+) | |||
CH1073-580F10 | BX248090.12 | 98.66% | pos 22946 (R+) | |||
CH1073-60F24 | BX248090.12 | 98.54% | pos 77259 (R-) | |||
CH1073-642I4 | CR392368.7 | 97.9% | pos 71607 (F+) | |||
CH1073-654M24 | BX248090.12 | 100% | pos 178175 (F+) | |||
CH1073-674E15 | CR392368.7 | 98.55% | pos 81960 (R+) | BX248090.12 | 100% | pos 177933 (F+) |
CH1073-674P8 | BX248090.12 | 97.97% | pos 76109 (R-) | BX248090.12 | 97.72% | pos 43780 (F+) |
CH1073-694J1 | BX248090.12 | 99.27% | pos 73808 (F+) | |||
CH1073-69L8 | CR392368.7 | 97.85% | pos 36834 (R+) | CR392368.7 | 98.14% | pos 37012 (F+) |
CH1073-6M12 | BX248090.12 | 97.36% | pos 121352 (R-) | BX248090.12 | 97.04% | pos 121276 (F-) |
CH1073-705G7 | BX248090.12 | 99.02% | pos 153353 (R-) | |||
CH1073-706E1 | BX248090.12 | 100% | pos 149289 (F+) | |||
CH1073-71C6 | CR392368.7 | 98.82% | pos 79277 (R+) | CR392368.7 | 98.97% | pos 79181 (F+) |
BX248090.12 | 99.19% | pos 169260 (R+) | ||||
CH1073-742C18 | BX248090.12 | 98.88% | pos 54988 (R-) | |||
CH1073-751D19 | BX248090.12 | 98.42% | pos 27770 (R+) | |||
CH1073-761H8 | CR392368.7 | 99.11% | pos 66255 (F-) | |||
CH1073-775G17 | BX248090.12 | 98.79% | pos 193306 (R+) | CR392368.7 | 99.58% | pos 62079 (F+) |
CH1073-782N2 | BX248090.12 | 97.08% | pos 163797 (R+) | CR392368.7 | 97.24% | pos 87027 (F+) |
BX248090.12 | 97.24% | pos 196202 (F-) | ||||
CH1073-821H24 | CR392368.7 | 99.03% | pos 46466 (F+) | |||
CH1073-836L3 | BX248090.12 | 98.49% | pos 49762 (F-) | |||
CH1073-855J7 | BX248090.12 | 98.46% | pos 79184 (R-) | BX248090.12 | 99.07% | pos 49203 (F+) |
CH1073-901I4 | CR392368.7 | 98.09% | pos 56136 (R-) | |||
CH1073-909B9 | BX248090.12 | 98.15% | pos 79304 (R-) | |||
CH1073-909C10 | BX248090.12 | 97.46% | pos 62234 (R-) | |||
CH1073-935M20 | BX248090.12 | 97.3% | pos 92453 (R-) | |||
CH1073-939L2 | CR392368.7 | 98.64% | pos 24205 (F+) | |||
CH1073-946H23 | BX248090.12 | 98.56% | pos 49991 (F+) | |||
BX248090.12 | 98.54% | pos 49991 (F+) | ||||
CH1073-94G20 | BX248090.12 | 97.51% | pos 99405 (F+) | |||
CH1073-95K3 | BX248090.12 | 97.02% | pos 163094 (R+) | |||
ZFOS-114A2 | CR392368.7 | 100% | pos 28418 (F-) | |||
ZFOS-1364H3 | CR392368.7 | 99.14% | pos 37309 (F-) | |||
ZFOS-1400B8 | BX248090.12 | 98.26% | pos 47288 (R-) | |||
ZFOS-1408G1 | CR392368.7 | 100% | pos 63572 (R-) | |||
ZFOS-1458A2 | CR392368.7 | 100% | pos 18313 (R-) | |||
ZFOS-1474A7 | BX248090.12 | 98.76% | pos 62884 (R-) | |||
ZFOS-1607H1 | BX248090.12 | 99.68% | pos 38587 (R-) | |||
ZFOS-1680F7 | BX248090.12 | 98.16% | pos 131753 (F-) | |||
ZFOS-184F12 | CR392368.7 | 100% | pos 70228 (R+) | BX248090.12 | 99.85% | pos 174374 (F+) |
ZFOS-2497G9 | BX248090.12 | 100% | pos 21169 (R+) | BX248090.12 | 99.51% | pos 63972 (F-) |
ZFOS-2500G4 | BX248090.12 | 99.87% | pos 36102 (R+) | BX248090.12 | 99.81% | pos 72255 (F-) |
ZFOS-2622B7 | BX248090.12 | 100% | pos 144730 (R-) | |||
ZFOS-2701A9 | BX248090.12 | 100% | pos 59658 (R-) | BX248090.12 | 100% | pos 20302 (F+) |
ZFOS-2804B7 | BX248090.12 | 100% | pos 133793 (R+) | BX248090.12 | 100% | pos 173912 (F-) |
ZFOS-287A1 | BX248090.12 | 100% | pos 22130 (F-) | |||
ZFOS-2946D3 | BX248090.12 | 100% | pos 186210 (R+) | |||
ZFOS-339E6 | BX248090.12 | 100% | pos 62182 (R-) | BX248090.12 | 100% | pos 25483 (F+) |
ZFOS-391E11 | BX248090.12 | 99.3% | pos 170180 (R-) | BX248090.12 | 98.16% | pos 131666 (F+) |
ZFOS-470G5 | BX248090.12 | 97.54% | pos 44607 (F+) | |||
ZFOS-621A2 | BX248090.12 | 99.01% | pos 134282 (R-) | |||
ZFOS-635B3 | BX248090.12 | 99.18% | pos 22692 (R-) | |||
ZFOS-780G7 | BX248090.12 | 98.14% | pos 131645 (R-) | |||
ZFOS-786C2 | BX248090.12 | 98.4% | pos 133639 (F-) | |||
ZFOS-863H8 | BX248090.12 | 99.69% | pos 132840 (R-) | |||
ZFOS-867F4 | BX248090.12 | 99.82% | pos 132987 (R-) | |||
ZFOS-91D12 | BX248090.12 | 98.92% | pos 156420 (R+) | BX248090.12 | 98.66% | pos 195908 (F-) |
ZFOS-99G4 | CR392368.7 | 99.8% | pos 65734 (R+) | BX248090.12 | 99.64% | pos 178828 (F+) |