 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Feb 02, 2012 |
| Title |
ADAR2-/- replicate 2 |
| Sample type |
SRA |
| |
|
| Source name |
female E11.5 whole embryo
|
| Organism |
Mus musculus |
| Characteristics |
gender: female
genotype/variation: ADAR2-/-
tissue: whole embryo
developmental stage: E11.5
replicate #: 2nd
strain: SV129
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Female mouse embryos were dissected on E11.5, homogenized and total RNA was extracted using peqGOLD TriFast reagent according to manufacturer's instructions (PEQLAB Biotechnologie GmbH, Erlangen, Germany). DNA for genotyping was extracted from the remaining amnions and sex determination was performed as described (Lambert et al. 2000). Total RNA was enriched for small RNAs (<200 nucleotides) using the mirVana miRNA Isolation Kit (Ambion, Applied Biosystems). Small RNAs were 5'-end labeled with 20μCi [γ-32P] ATP using T4 polynucleotide kinase (Fermentas). Radiolabeled RNA was separated on 15% 19:1 AA:bisAA gels (8M UREA in 1xTBE) and exposed to X-ray films. RNA bands between 19-25 nucleotides were cut out and eluted in 400ul elution buffer (500mM NH4OAc, 0.2%SDS, 100mM EDTA) at room temperature over night. Eluted samples were purified over Sephadex G-25 spin-columns and precipitated. The size selected RNA was ligated to a 5' pre-adenylated and 3' blocked 3'-end adapter (5'-Appp- UCGUAUGCCGUCUUCUGCUUGUidT-3') using truncated T4 RNA Ligase 2, (New England Biolabs) with the supplied buffer and a final concentration of 20% PEG6000. Ligations were incubated for 6 hours at room temperature followed by 4C over night. Ligation products were purified on a 10% denaturing PAGE next to radiolabeled markers and ligated to the 5'adapter (5'-GUUCAGAGUUCUACAGUCCGACGAUC- 3') using T4 RNA Ligase 1 (New England Biolabs) with the supplied buffer and 20% PEG. Again, the ligation product was purified on a denaturing PAGE. The final product was reverse transcribed using RevertAid H Minus Reverse Transcriptase (Fermentas) using RT primer 5'-CAAGCAGAAGACGGCATACGA-3' following manufacturer's instructions. The cDNA was used as template for 15 cycles of PCR amplification (forward primer: 5'- AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA-3', reverse primer: 5'-CAAGCAGAAGACGGCATACGA3') using Phusion High-Fidelity DNA Polymerase (Finnzymes) according to manufacturer's protocol. PCR products were separated on a non-denaturing 6% AA TBE gel and stained with ethidiumbromide in 1x TBE. Bands of approximately 100bp corresponding to the final mature miRNA library were cut out and eluted in 400 ul elution buffer (0.5M NH4OAc, 1mM EDTA, pH 8.1) over night at room temperature. DNA was precipitated and subsequently resuspended in 10ul 1x TE.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina Genome Analyzer II |
| |
|
| Data processing |
reads_r4s2.txt; genome build: miRBase Release 16
Small RNA sequences were mapped to mature miRNA sequences annotated in miRBase Release 16 (miRBase, http://www.mirbase.org/). The mapping was performed using NextGenMap (FJ Sedlazeck, S Tauber, GB Ewing, and A von Haeseler, submitted) and allowed for up to two mismatches.
|
| |
|
| Submission date |
Dec 21, 2011 |
| Last update date |
May 15, 2019 |
| Contact name |
Stefanie Tauber |
| E-mail(s) |
stefanie.tauber@univie.ac.at
|
| Organization name |
MFPL
|
| Department |
CIBIV
|
| Street address |
Dr. Bohr-Gasse 9
|
| City |
Vienna |
| ZIP/Postal code |
1030 |
| Country |
Austria |
| |
|
| Platform ID |
GPL9250 |
| Series (1) |
| GSE34626 |
Adenosine deaminases that act on RNA induce reproducible changes in abundance and sequence of embryonic miRNAs |
|
| Relations |
| SRA |
SRX112714 |
| BioSample |
SAMN00767966 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM852144_reads_r4s2.txt.gz |
4.9 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
