 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 25, 2010 |
| Title |
Zebrafish Embryo small RNAs |
| Sample type |
SRA |
| |
|
| Source name |
Embryo Cells
|
| Organism |
Danio rerio |
| Characteristics |
data type: small RNAs
tissue: embryo
|
| Extracted molecule |
total RNA |
| Extraction protocol |
The small RNA cDNA libraries were made as described (Grimson et al. 2008), except for the 3' adaptor ligation, which was 5' adenylated pTCGTATGCCGTCTTCTGCTTGidT. For a detailed protocol, see http://web.wi.mit.edu/bartel/pub/protocols.html.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina Genome Analyzer |
| |
|
| Description |
Size fraction(18-30nt)
|
| Data processing |
Small RNA sequences from same total RNA samples were mapped to the human genome (hg18), requiring a perfect match, and reads co-localizing to annotated miRNA loci (miRBase, version 11.0) were counted.
sequence reads are summarized as frequency counts
|
| |
|
| Submission date |
Jun 01, 2010 |
| Last update date |
May 15, 2019 |
| Contact name |
Jin-Wu Nam |
| E-mail(s) |
jwnam@wi.mit.edu
|
| Organization name |
Whitehead Institute
|
| Lab |
Bartel lab
|
| Street address |
Nine Cambridge Center
|
| City |
Cambridge |
| State/province |
MA |
| ZIP/Postal code |
02142 |
| Country |
USA |
| |
|
| Platform ID |
GPL10164 |
| Series (1) |
| GSE22068 |
Expanding the MicroRNA Targeting Code: A Novel Type of Site with Centered Pairing |
|
| Relations |
| SRA |
SRX022206 |
| BioSample |
SAMN00015220 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM548640_Zebrafish_embryo_24h.processed.txt.gz |
1.7 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Processed data provided as supplementary file |
| Raw data are available in SRA |
|
|
|
|
 |
