U.S. flag

An official website of the United States government

Format

Send to:

Choose Destination

MIR167b [ Arabidopsis thaliana (thale cress) ]

Gene ID: 3769776, updated on 11-Sep-2024

Summary

Go to the top of the page Help
Official Symbol
MIR167b
Primary source
TAIR:AT3G63375
Locus tag
AT3G63375
See related
Araport:AT3G63375
Gene type
ncRNA
Organism
Arabidopsis thaliana (ecotype: Columbia)
Lineage
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Camelineae; Arabidopsis
Also known as
microRNA167B; MIR167B; p_MI0000209
Summary
Encodes a microRNA that targets ARF family members ARF6 and ARF8. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage.Mature sequence: UGAAGCUGCCAGCAUGAUCUA
NEW
Try the new Gene table
Try the new Transcript table

Genomic context

Go to the top of the page Help
Location:
chromosome: 3
Exon count:
1
Sequence:
Chromosome: 3; NC_003074.8 (23406168..23406276)

Chromosome 3 - NC_003074.8Genomic Context describing neighboring genes Neighboring gene defensin-like protein Neighboring gene Tetratricopeptide repeat (TPR)-like superfamily protein Neighboring gene ATPase E1-E2 type family protein / haloacid dehalogenase-like hydrolase family protein Neighboring gene uncharacterized protein

Genomic regions, transcripts, and products

Go to the top of the page Help
Genomic Sequence:
NC_003074.8

Go to nucleotide: Graphics FASTA GenBank

Bibliography

Go to the top of the pageHelp

Related articles in PubMed

  1. An Essential Role for miRNA167 in Maternal Control of Embryonic and Seed Development. Yao X, et al. Plant Physiol, 2019 May. PMID 30867333, Free PMC Article
  2. Cell-specific nitrogen responses mediate developmental plasticity. Gifford ML, et al. Proc Natl Acad Sci U S A, 2008 Jan 15. PMID 18180456, Free PMC Article
  3. Computational identification of plant microRNAs and their targets, including a stress-induced miRNA. Jones-Rhoades MW, et al. Mol Cell, 2004 Jun 18. PMID 15200956

GeneRIFs: Gene References Into Functions

What's a GeneRIF?
  1. MIR167B plays minor roles in Arabidopsis development.
    Title: An Essential Role for miRNA167 in Maternal Control of Embryonic and Seed Development.
Submit: New GeneRIF Correction

General gene information

Go to the top of the page Help
  • mature miRNA accession:MIMAT0000197

Gene Ontology Provided by TAIR

Function Evidence Code Pubs
enables molecular_function ND
No biological Data available
more info
  
Process Evidence Code Pubs
acts_upstream_of_or_within cellular response to nitrogen levels IEP
Inferred from Expression Pattern
more info
 PubMed 
acts_upstream_of_or_within miRNA-mediated post-transcriptional gene silencing TAS
Traceable Author Statement
more info
 PubMed 
Component Evidence Code Pubs
is_active_in cellular_component ND
No biological Data available
more info
  

NCBI Reference Sequences (RefSeq)

Go to the top of the page Help

NEW Try the new Transcript table

Genome Annotation

The following sections contain reference sequences that belong to a specific genome build. Explain

Reference assembly

Genomic

  1. NC_003074.8 Reference assembly

    Range
    23406168..23406276
    Download
    GenBank, FASTA, Sequence Viewer (Graphics)

RNA

  1. NR_141709.1 RNA Sequence

    Status: REVIEWED

Gene LinkOut

The following LinkOut resources are supplied by external providers. These providers are responsible for maintaining the links.

Molecular Biology Databases
Research Materials