ClinVar Genomic variation as it relates to human health
NM_000179.3(MSH6):c.1507_1519dup (p.Arg507delinsIleGlnValTer)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000179.3(MSH6):c.1507_1519dup (p.Arg507delinsIleGlnValTer)
Variation ID: 2673695 Accession: VCV002673695.1
- Type and length
-
Duplication, 13 bp
- Location
-
Cytogenetic: 2p16.3 2: 48026625-48026626 (GRCh37) [ NCBI UCSC ] 2: 47799486-47799487 (GRCh38) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Dec 25, 2023 Dec 24, 2023 Aug 14, 2023 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_000179.3:c.1507_1519dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000170.1:p.Arg507delinsIleGlnValTer nonsense NM_001281492.2:c.1117_1129dup NP_001268421.1:p.Arg377delinsIleGlnValTer nonsense NM_001281493.2:c.601_613dup NP_001268422.1:p.Arg205delinsIleGlnValTer nonsense NM_001281494.2:c.601_613dup NP_001268423.1:p.Arg205delinsIleGlnValTer nonsense NM_001406795.1:c.1603_1615dup NP_001393724.1:p.Arg539delinsIleGlnValTer nonsense NM_001406796.1:c.1507_1519dup NP_001393725.1:p.Arg507delinsIleGlnValTer nonsense NM_001406797.1:c.1210_1222dup NP_001393726.1:p.Arg408delinsIleGlnValTer nonsense NM_001406798.1:c.1507_1519dup NP_001393727.1:p.Arg507delinsIleGlnValTer nonsense NM_001406799.1:c.982_994dup NP_001393728.1:p.Arg332delinsIleGlnValTer nonsense NM_001406800.1:c.1507_1519dup NP_001393729.1:p.Arg507delinsIleGlnValTer nonsense NM_001406801.1:c.1210_1222dup NP_001393730.1:p.Arg408delinsIleGlnValTer nonsense NM_001406802.1:c.1603_1615dup NP_001393731.1:p.Arg539delinsIleGlnValTer nonsense NM_001406803.1:c.1507_1519dup NP_001393732.1:p.Arg507delinsIleGlnValTer nonsense NM_001406804.1:c.1429_1441dup NP_001393733.1:p.Arg481delinsIleGlnValTer nonsense NM_001406805.1:c.1210_1222dup NP_001393734.1:p.Arg408delinsIleGlnValTer nonsense NM_001406806.1:c.982_994dup NP_001393735.1:p.Arg332delinsIleGlnValTer nonsense NM_001406807.1:c.982_994dup NP_001393736.1:p.Arg332delinsIleGlnValTer nonsense NM_001406808.1:c.1507_1519dup NP_001393737.1:p.Arg507delinsIleGlnValTer nonsense NM_001406809.1:c.1507_1519dup NP_001393738.1:p.Arg507delinsIleGlnValTer nonsense NM_001406811.1:c.601_613dup NP_001393740.1:p.Arg205delinsIleGlnValTer nonsense NM_001406812.1:c.601_613dup NP_001393741.1:p.Arg205delinsIleGlnValTer nonsense NM_001406813.1:c.1513_1525dup NP_001393742.1:p.Arg509delinsIleGlnValTer nonsense NM_001406814.1:c.601_613dup NP_001393743.1:p.Arg205delinsIleGlnValTer nonsense NM_001406815.1:c.601_613dup NP_001393744.1:p.Arg205delinsIleGlnValTer nonsense NM_001406816.1:c.601_613dup NP_001393745.1:p.Arg205delinsIleGlnValTer nonsense NM_001406817.1:c.1507_1519dup NP_001393746.1:p.Arg507delinsIleGlnValTer nonsense NM_001406818.1:c.1210_1222dup NP_001393747.1:p.Arg408delinsIleGlnValTer nonsense NM_001406819.1:c.1210_1222dup NP_001393748.1:p.Arg408delinsIleGlnValTer nonsense NM_001406820.1:c.1210_1222dup NP_001393749.1:p.Arg408delinsIleGlnValTer nonsense NM_001406821.1:c.1210_1222dup NP_001393750.1:p.Arg408delinsIleGlnValTer nonsense NM_001406822.1:c.1210_1222dup NP_001393751.1:p.Arg408delinsIleGlnValTer nonsense NM_001406823.1:c.601_613dup NP_001393752.1:p.Arg205delinsIleGlnValTer nonsense NM_001406824.1:c.1210_1222dup NP_001393753.1:p.Arg408delinsIleGlnValTer nonsense NM_001406825.1:c.1210_1222dup NP_001393754.1:p.Arg408delinsIleGlnValTer nonsense NM_001406826.1:c.1339_1351dup NP_001393755.1:p.Arg451delinsIleGlnValTer nonsense NM_001406827.1:c.1210_1222dup NP_001393756.1:p.Arg408delinsIleGlnValTer nonsense NM_001406828.1:c.1210_1222dup NP_001393757.1:p.Arg408delinsIleGlnValTer nonsense NM_001406829.1:c.601_613dup NP_001393758.1:p.Arg205delinsIleGlnValTer nonsense NM_001406830.1:c.1210_1222dup NP_001393759.1:p.Arg408delinsIleGlnValTer nonsense NM_001407362.1:c.628-1176_628-1164dup intron variant NR_176257.1:n.1596_1608dup non-coding transcript variant NR_176258.1:n.1596_1608dup non-coding transcript variant NR_176259.1:n.1596_1608dup non-coding transcript variant NR_176261.1:n.1596_1608dup non-coding transcript variant NC_000002.12:g.47799490_47799502dup NC_000002.11:g.48026629_48026641dup NG_007111.1:g.21344_21356dup LRG_219:g.21344_21356dup LRG_219t1:c.1507_1519dup LRG_219p1:p.Arg507Ilefs - Protein change
- Other names
- -
- Canonical SPDI
- NC_000002.12:47799486:ATATCCAAGTATGATA:ATATCCAAGTATGATATCCAAGTATGATA
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
MSH6 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
9038 | 9344 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (1) |
criteria provided, single submitter
|
Aug 14, 2023 | RCV003450332.1 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Aug 14, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Lynch syndrome 5
Affected status: unknown
Allele origin:
unknown
|
Myriad Genetics, Inc.
Accession: SCV004187172.1
First in ClinVar: Dec 24, 2023 Last updated: Dec 24, 2023 |
Comment:
This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation.
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpThere are no citations for germline classification of this variant in ClinVar. If you know of citations for this variation, please consider submitting that information to ClinVar. |
Text-mined citations for this variant ...
HelpRecord last updated Dec 30, 2023
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.