ClinVar Genomic variation as it relates to human health
NM_000465.4(BARD1):c.1075_1095del (p.Leu359_Pro365del)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000465.4(BARD1):c.1075_1095del (p.Leu359_Pro365del)
Variation ID: 140795 Accession: VCV000140795.40
- Type and length
-
Deletion, 21 bp
- Location
-
Cytogenetic: 2q35 2: 214780779-214780799 (GRCh38) [ NCBI UCSC ] 2: 215645503-215645523 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Aug 6, 2014 Feb 20, 2024 Feb 1, 2024 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_000465.4:c.1075_1095del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000456.2:p.Leu359_Pro365del NM_000465.2:c.1075_1095delTTGCCTGAATGTTCTTCACCA NM_000465.3:c.1075_1095delTTGCCTGAATGTTCTTCACCA NM_001282543.2:c.1018_1038del NP_001269472.1:p.Leu340_Pro346del NM_001282545.2:c.215+16262_215+16282del NM_001282548.2:c.159-28244_159-28224del NM_001282549.2:c.364+11498_364+11518del NR_104212.2:n.1040_1060del NR_104215.2:n.983_1003del NC_000002.12:g.214780783_214780803del NC_000002.11:g.215645507_215645527del NG_012047.3:g.33913_33933del LRG_297:g.33913_33933del LRG_297t1:c.1075_1095del LRG_297p1:p.Leu359_Pro365del - Protein change
- Other names
- NP_000456.2:p.Leu359_Pro365del
- Canonical SPDI
- NC_000002.12:214780778:TGGTGAAGAACATTCAGGCAATGGT:TGGT
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
0.04473 (TGGT)
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
BARD1 | Sufficient evidence for dosage pathogenicity | No evidence available |
GRCh38 GRCh37 |
3943 | 3997 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Benign (4) |
criteria provided, multiple submitters, no conflicts
|
Oct 20, 2020 | RCV000128959.9 | |
Benign/Likely benign (7) |
criteria provided, multiple submitters, no conflicts
|
Feb 1, 2024 | RCV000197321.29 | |
Benign (4) |
criteria provided, multiple submitters, no conflicts
|
Aug 15, 2023 | RCV000506514.14 | |
Benign/Likely benign (2) |
criteria provided, multiple submitters, no conflicts
|
Nov 3, 2021 | RCV001711296.6 | |
Benign (1) |
criteria provided, single submitter
|
Apr 19, 2022 | RCV002225421.3 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Benign
(Sep 17, 2012)
|
criteria provided, single submitter
Method: clinical testing
|
Neoplastic Syndromes, Hereditary
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV000172828.1
First in ClinVar: Aug 06, 2014 Last updated: Aug 06, 2014 |
|
|
Benign
(Nov 18, 2014)
|
criteria provided, single submitter
Method: clinical testing
|
Neoplastic Syndromes, Hereditary
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV000172840.2
First in ClinVar: Aug 06, 2014 Last updated: Mar 24, 2015 |
|
|
Benign
(Jul 19, 2016)
|
criteria provided, single submitter
Method: clinical testing
|
not specified
Affected status: unknown
Allele origin:
germline
|
PreventionGenetics, part of Exact Sciences
Accession: SCV000806098.1
First in ClinVar: Apr 09, 2018 Last updated: Apr 09, 2018 |
|
|
Benign
(Apr 19, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary breast ovarian cancer syndrome
Affected status: yes
Allele origin:
germline
|
National Health Laboratory Service, Universitas Academic Hospital and University of the Free State
Accession: SCV002505127.1
First in ClinVar: Apr 29, 2022 Last updated: Apr 29, 2022 |
Number of individuals with the variant: 29
Geographic origin: South Africa
|
|
Benign
(Jun 12, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV000209819.5
First in ClinVar: Feb 24, 2015 Last updated: Mar 04, 2023 |
|
|
Likely benign
(May 28, 2019)
|
criteria provided, single submitter
Method: clinical testing
|
Familial cancer of breast
Affected status: unknown
Allele origin:
unknown
|
Mendelics
Accession: SCV001136192.1
First in ClinVar: Jan 09, 2020 Last updated: Jan 09, 2020 |
|
|
Likely benign
(Jan 01, 2019)
|
criteria provided, single submitter
Method: clinical testing
|
Familial cancer of breast
Affected status: yes
Allele origin:
unknown
|
Institute of Human Genetics, University of Leipzig Medical Center
Accession: SCV001440744.1
First in ClinVar: Oct 30, 2020 Last updated: Oct 30, 2020 |
|
|
Benign
(Oct 20, 2020)
|
criteria provided, single submitter
Method: curation
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Sema4, Sema4
Accession: SCV002526981.1
First in ClinVar: Jun 24, 2022 Last updated: Jun 24, 2022 |
|
|
Benign
(Nov 14, 2014)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary cancer-predisposing syndrome
Affected status: unknown
Allele origin:
germline
|
Color Diagnostics, LLC DBA Color Health
Accession: SCV000682666.2
First in ClinVar: Feb 19, 2018 Last updated: Dec 11, 2022 |
|
|
Benign
(Jul 06, 2016)
|
criteria provided, single submitter
Method: clinical testing
|
Familial cancer of breast
Affected status: unknown
Allele origin:
unknown
|
Counsyl
Accession: SCV000488863.2
First in ClinVar: Oct 11, 2015 Last updated: Dec 24, 2022 |
|
|
Benign
(Jul 08, 2020)
|
criteria provided, single submitter
Method: clinical testing
|
not specified
Affected status: unknown
Allele origin:
unknown
|
Quest Diagnostics Nichols Institute San Juan Capistrano
Accession: SCV000887577.3
First in ClinVar: Mar 13, 2019 Last updated: Dec 31, 2022 |
|
|
Likely benign
(Nov 03, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: not provided
Allele origin:
germline
|
Institute for Clinical Genetics, University Hospital TU Dresden, University Hospital TU Dresden
Accession: SCV002009159.3
First in ClinVar: Nov 06, 2021 Last updated: Jul 16, 2023 |
|
|
Benign
(Jul 07, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Familial cancer of breast
Affected status: yes
Allele origin:
germline
|
KCCC/NGS Laboratory, Kuwait Cancer Control Center
Accession: SCV004016358.1
First in ClinVar: Jul 29, 2023 Last updated: Jul 29, 2023 |
|
|
Benign
(Feb 24, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Familial cancer of breast
Affected status: unknown
Allele origin:
unknown
|
Myriad Genetics, Inc.
Accession: SCV004019237.1
First in ClinVar: Jul 29, 2023 Last updated: Jul 29, 2023 |
Comment:
This variant is considered benign. This variant has been observed at a population frequency that is significantly greater than expected given the associated disease prevalence … (more)
This variant is considered benign. This variant has been observed at a population frequency that is significantly greater than expected given the associated disease prevalence and penetrance. This variant is strongly associated with less severe personal and family histories of cancer, typical for individuals without pathogenic variants in this gene [PMID: 25085752]. (less)
|
|
Benign
(Aug 15, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not specified
Affected status: unknown
Allele origin:
germline
|
Center for Genomic Medicine, Rigshospitalet, Copenhagen University Hospital
Accession: SCV002760244.3
First in ClinVar: Dec 17, 2022 Last updated: Aug 18, 2023 |
|
|
Benign
(Feb 01, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Familial cancer of breast
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV000252703.10
First in ClinVar: Oct 11, 2015 Last updated: Feb 20, 2024 |
|
|
Benign
(Oct 27, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Familial cancer of breast
Affected status: unknown
Allele origin:
germline
|
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories
Accession: SCV000885061.9
First in ClinVar: Feb 18, 2019 Last updated: Feb 20, 2024 |
|
|
Benign
(-)
|
no assertion criteria provided
Method: clinical testing
|
not specified
Affected status: yes
Allele origin:
unknown
|
Department of Pathology and Laboratory Medicine, Sinai Health System
Additional submitter:
Franklin by Genoox
Study: The Canadian Open Genetics Repository (COGR)
Accession: SCV001549936.1 First in ClinVar: Apr 13, 2021 Last updated: Apr 13, 2021 |
Comment:
The BARD1 p.Leu359_Pro365del variant was identified in 19 of 926 proband chromosomes (frequency: 0.0205) from individuals or families with hereditary breast and ovarian cancer and … (more)
The BARD1 p.Leu359_Pro365del variant was identified in 19 of 926 proband chromosomes (frequency: 0.0205) from individuals or families with hereditary breast and ovarian cancer and was present in 4 of 140 control chromosomes (frequency: 0.03) from healthy individuals, and is reported in the literature as a polymorphism (De Brakeleer 2010, De Brakeleer 2015, Ishitobi 2003, Liu 2017, Irminger-Finger 2015). The variant was also identified in ClinVar as benign (by Ambry Genetics, GeneDx, Invitae, and Counsyl), and the Zhejiang Colon Cancer Database. The variant was not identified in Cosmic, and MutDB databases. The variant was identified in control databases in 7807 of 277012 chromosomes at a frequency of 0.03 increasing the likelihood this could be a low frequency benign variant (Genome Aggregation Consortium Feb 27, 2017). The variant was identified in the following populations at a frequency greater than 1%: South Asian (52 homozygous) in 2152 of 30774 chromosomes (freq: 0.07), East Asian (8 homozygous) in 834 of 18854 chromosomes (freq: 0.044), African (9 homozygous) in 986 of 24026 chromosomes (freq: 0.041), Latino (2 homozygous) in 1167 of 34380 chromosomes (freq: 0.034), Other in 209 of 6462 chromosomes (freq: 0.032), European (Non-Finnish) in 2254 of 126574 chromosomes (freq: 0.018), Ashkenazi Jewish in 118 of 10152 chromosomes (freq: 0.012). This variant is an in-frame deletion resulting in the removal of a 7 amino acid residues from codon 359 to 365; the impact of this alteration on BARD1 protein function is not known. The variant occurs outside of the splicing consensus sequence and in silico or computational prediction software programs (SpliceSiteFinder, MaxEntScan, NNSPLICE, GeneSplicer, HumanSpliceFinder) do not predict a difference in splicing. In summary, based on the above information this variant meets our laboratory's criteria to be classified as benign. (less)
|
|
click to load more click to collapse |
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
New concepts on BARD1: Regulator of BRCA pathways and beyond. | Irminger-Finger I | The international journal of biochemistry & cell biology | 2016 | PMID: 26738429 |
Development and validation of a new algorithm for the reclassification of genetic variants identified in the BRCA1 and BRCA2 genes. | Pruss D | Breast cancer research and treatment | 2014 | PMID: 25085752 |
BARD1 homozygous deletion, a possible alternative to BRCA1 mutation in basal breast cancer. | Sabatier R | Genes, chromosomes & cancer | 2010 | PMID: 20842729 |
Cancer predisposing missense and protein truncating BARD1 mutations in non-BRCA1 or BRCA2 breast cancer families. | De Brakeleer S | Human mutation | 2010 | PMID: 20077502 |
BARD1 variants are not associated with breast cancer risk in Australian familial breast cancer. | Gorringe KL | Breast cancer research and treatment | 2008 | PMID: 17972171 |
Mutational analysis of BARD1 in familial breast cancer patients in Japan. | Ishitobi M | Cancer letters | 2003 | PMID: 14550946 |
Germline mutations of the BRCA1-associated ring domain (BARD1) gene in breast and breast/ovarian families negative for BRCA1 and BRCA2 alterations. | Ghimenti C | Genes, chromosomes & cancer | 2002 | PMID: 11807980 |
Mutations in the BRCA1-associated RING domain (BARD1) gene in primary breast, ovarian and uterine cancers. | Thai TH | Human molecular genetics | 1998 | PMID: 9425226 |
Text-mined citations for rs28997575 ...
HelpRecord last updated Jun 02, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.