Instrument: Illumina HiSeq 2000
Strategy: DNase-Hypersensitivity
Source: GENOMIC
Selection: DNase
Layout: SINGLE
Construction protocol: Phenol-chloroform Libraries of DNA fragments from chromatin immunoprecipitation or DNase I treatment were prepared from approximately 10 ng of DNA. Firstly, overhangs were repaired by treatment of sample material with T4 DNA polymerase, T4 PNK and Klenow DNA polymerase (all enzymes obtained from New England Biolabs UK) in a reaction also containing 50 mM Tris-HCl,10 mM MgCl2, 10 mM Dithiothreitol, 0.4 mM dNTPs and 1 mM ATP. Samples were purified after each step using Qiagen MinElute columns (according to the manufacturer's guidelines). Adenosine bases were added to 3' ends of fragments using Klenow Fragment (3´- 5´ exo-minus), allowing for subsequent ligation of adapter oligonucleotides (Illumina part #1000521) using Quick T4 DNA ligase. After a further column clean up to remove excess adaptors, fragments were amplified in an 18 cycle PCR reaction using adapter-specific primers (sequences 5'- CAAGCAGAAGACGGCATACGAGCTCTTCCGATC*T and 5'-AATGATACGGCGACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T). The libraries were purified and adapter dimers removed by running PCR products on 2% agarose gels and excising gel slices corresponding to fragments approximately 200-300 bp in size, which were then extracted using the Qiagen gel extraction kit. Libraries were validated using quantitative PCR for known targets, and quality assessed by running 1 μl each sample on an Agilent Technologies 2100 Bioanalyser. Once prepared, DNA libraries were subject to massively parallel DNA sequencing on an Illumina Genome Analyzer. ETO, RUNX1, C/EBPα, PU.1, LMO2 ChIP and Kasumi-1 DNase I libraries were sequenced employing the Illumina Genome Analyzer GAIIx, by using 36 base pair single end reads.