U.S. flag

An official website of the United States government

Format

Send to:

Choose Destination

SRX3889273: GSM3082708: D14-NC-TMZ; Homo sapiens; OTHER
1 ILLUMINA (HiSeq X Ten) run: 14.3M spots, 4.3G bases, 1.9Gb downloads

Submitted by: NCBI (GEO)
Study: A genome-wide screen identifies E2F6 as critical factor for TMZ chemoresistance in EGFRvIII expressing GBM (DNA-seq)
show Abstracthide Abstract
We conducted a genome-wide screen by clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9 library to identify genes which are particularly resistant to EGFRvIII GBM cells under the chemo-stress of TMZ. In vitro and in vivo validation of EGFRvIII-specific targets revealed several strong hits, including E2F6. Mechanistic studies demonstrated that E2F6 reveals its resistance to TMZ through NF-?B and TMZ inducement. Overall design: A pooled genome-wide CRISPR-Cas9-based screen using a sgRNA lentiviral library harboring 123,411 sgRNAs which target 20,914 human genes were performed to transduce EGFRwt and EGFRvIII U87 cells ( no replicate), then treated with TMZ for 7 and 14 days. The end time point of each screen was compared to day 0 in order to determine which sgRNAs were overrepresented or underrepresented in the population.
Sample: D14-NC-TMZ
SAMN08868551 • SRS3127145 • All experiments • All runs
Organism: Homo sapiens
Library:
Instrument: HiSeq X Ten
Strategy: OTHER
Source: GENOMIC
Selection: other
Layout: PAIRED
Construction protocol: Genomic DNA extraction were preformed by a ammonium acetate and alcohol precipitation precedures. 1*10^8 cells were homogenized in 15 mL 4 M guanidine thiocyanate with RNaseA, after incubated at 37 oC for 30 mins,15 mL 8 M ammonium acetate were added and mixing. To precipitate DNA, 15 mL isopanol were added and mixing vigorously, the DNA were hooked to a new tube and washed by 70% ethanol. DNA were dissolved in 3 mL TE and extacted by 2 round of choloform. Two-step PCR amplification were performed on genomic DNA using Hifi DNA polymerase (Vazyme). The first PCR using Outer-F(CTTGGCTTTATATATCTTGTGGAAAGGAC)and Outer-R(GGAAAAAGGCGGAGCCAGTACACGAC) to primeramplification the region containing sgRNA cassette. The second PCR included amplification to attach Illumina adaptors and to barcode samples(F:AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTgtggaaaggacgaaacaccg, R:CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGCCAGTACACGACATCACTTTCC).The samples were multiplexing and sequencing in a single HiSeq-X run.
Experiment attributes:
GEO Accession: GSM3082708
Links:
Runs: 1 run, 14.3M spots, 4.3G bases, 1.9Gb
Run# of Spots# of BasesSizePublished
SRR694562614,261,0374.3G1.9Gb2020-06-04

ID:
5342598

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...