Name: GSM8292150
Instrument: Illumina HiSeq 2500
Strategy: ncRNA-Seq
Source: TRANSCRIPTOMIC
Selection: size fractionation
Layout: SINGLE
Construction protocol: CLASH : 1e+8 OSCs were washed once with ice-cold PBS and then irradiated with 200 mJ/cm2 at 254 nm. Cells were pelleted and lysed in lysis buffer (20 mM HEPES-KOH pH 7.3, 150 mM NaCl, 1 mM EDTA, 1 mM DTT, 0.5% NP-40, 2 μg/ml Pepstatin, 2 μg/ml Leupeptin, 0.5% Aprotinin). Lysates were centrifuged at 20,000 g for 10 min at 4˚C, and the supernatants treated with 1 U/μl RNase T1 (Roche) for 15 min at room temperature on a rotator. RNA-protein complexes were immunoprecipitated using 10 μg of anti-Piwi antibody (Saito et al., 2006) and 100 μl Dynabeads protein G (Invitrogen) for 2 h at 4˚C. Beads were washed three times with wash buffer (20 mM HEPES-KOH pH 7.3, 300 mM NaCl, 1 mM DTT, 0.05% NP-40, 2 μg/ml Pepstatin, 2 μg/ml Leupeptin, 0.5% Aprotinin), and three times with high-salt wash buffer (20 mM HEPES-KOH pH 7.3, 500 mM NaCl, 1 mM DTT, 0.05% NP-40, 2 μg/ml Pepstatin, 2 μg/ml Leupeptin, 0.5% Aprotinin). The beads were resuspended in 100 μl PNK buffer (1 × PNK buffer, 6,000 Ci/mmol 32P-γ-ATP (Perkin Elmer), 10 units T4 Polynucleotide kinase (NEB), 40 units RNasin (Promega)) and incubated for 30 min at 37˚C. Piwi-piRNA complexes were washed 5 times with PNK wash buffer (50 mM Tris-HCl pH 7.5, 50 mM NaCl, 10 mM MgCl2). Piwi-bound, interacting RNA molecules were ligated overnight using 25 units of T4 RNA ligase 1 (NEB) in T4 RNA ligase buffer (1 × T4 RNA ligase buffer, 1 mM ATP, 15% PEG8000, 40 units RNasin (Promega)) at 16˚C. The ligation mixture was washed 5 times with PNK wash buffer. Piwi-piRNA/RNA complexes were eluted in 1 × LDS sample buffer (Life Technologies) for 10 min at 70°C and then resolved on a 4%–12% Bis-Tris NuPAGE gel (Life Technologies) in NuPAGE SDS MOPS running buffer (Life Technologies). The Piwi-piRNA/RNA complexes were transferred to a nitrocellulose blotting membrane (GE Healthcare) in a wet-transfer tank with NuPAGE transfer buffer (Life Technologies) containing 10% methanol for 100 min at 30 V. After excising the region of nitrocellulose containing Piwi-piRNA/RNA complexes, RNAs were released from the membrane using 10 μl of Proteinase K (Roche) in proteinase K buffer (50 mM Tris-HCl pH 7.5, 75 mM NaCl, 6.25 mM EDTA, 10% SDS) for 30 min at 55˚C. The RNA was extracted with phenol/chloroform/isoamyl alcohol, and then precipitated with ethanol and PelletPaint NF (Millipore). RNA pellets were washed with 70% ethanol and dissolved in Nuclease-Free Water. CAGE & Iso-seq : Total RNA was extracted using Isogen II (Nippon Gene). Pacbio-DNAseq : High molecular weight DNA was extracted using Blood & Cell Culture DNA kit (Qiagen). piRNA-seq : 1e+8 OSCs were lysed in Lysis Buffer (20 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.5% NP-40, 1 mM EDTA, 1 mM DTT, 2 μg/ml Pepstatin, 2 μg/ml Leupeptin, 0.5% Aprotinin, 40 U/ml RNasin (Promega)) and spun at 135,000 rpm for 15 min at 4°C. The supernatant was collected and cooled on ice. 10 μg of Anti-Piwi antibody (Saito et al., 2006) was immobilised on 50 μl of Dynabeads protein G (Invitrogen) and incubated with lysates for 2 h at 4°C. The supernatant was discarded and the beads washed three times with IP wash buffer (20 mM Tris-HCl pH 7.5, 300 mM NaCl, 0.05% NP-40, 1 mM DTT, 2 μg/ml Pepstatin, 2 μg/ml Leupeptin, 0.5% Aprotinin) and three times with High salt buffer (20 mM Tris-HCl pH 7.5, 500 mM NaCl, 0.05% NP-40, 1 mM DTT, 2 μg/ml Pepstatin, 2 μg/ml Leupeptin, 0.5% Aprotinin). After washing, RNAs were extracted from the beads with acid phenol-chloroform and precipitated with ethanol. Purified RNAs were denatured in Gel Loading Buffer II (Invitrogen, AM8546G) for 5 min at 95°C, resolved on a denaturing 15% TBE polyacrylamide gel and sizes between 22-30 nt were excised. ChIP-seq : ChIP was performed as described in the ultra-low-input native ChIP (ULI-NChIP) protocol (Brind'Amour et al., 2015) with minor modifications. Briefly, 5e+5 OSCs were lysed in 20 μl of Nuclei EZ lysis buffer (Sigma Aldrich, N3408). The chromatin was digested with 10 U/μl of MNase (NEB) at 37°C for 10 min and the reaction quenched with 100 mM EDTA. The digested chromatin was then diluted in IP buffer (20 mM Tris-HCl pH 7.5, 1% Triton X-100, 2 mM EDTA and 150 mM NaCl, 1 x cOmplete Protease Inhibitor Cocktail (Roche)). An aliquot of chromatin (10 μl) was used as the input control. Chromatin was pre-cleared with 20 μl of 1:1 Dynabeads protein A (invitrogen) : Dynabeads protein G (invitrogen) and immunoprecipitated with antibody–bead complexes (1 μl of H3K9me3 antibody (abcam, ab8898) or 1 μl of H3K4me3 antibody (abcam, ab8580) in 10 μl of 1:1 protein A:protein G Dynabeads) overnight at 4°C. Immunopurified protein-DNA complexes were washed twice with 1 ml of Low salt buffer (20 mM Tris-HCl pH 7.5, 0.1% SDS, 1% Triton X-100, 2 mM EDTA and 150 mM NaCl) and once with 1 ml of High salt buffer (20 mM Tris-HCl pH 7.5, 0.1% SDS, 1% Triton X-100, 2 mM EDTA and 500 mM NaCl). After washing, protein-DNA complexes were eluted in 30 μl of elution buffer (50 mM Tris-HCl pH 7.5, 10 mM EDTA, 1% SDS). One hundred ng of RNAse A was added to the eluate and the mixture incubated for 30 min at 37°C, followed by 90 min at 65°C. Lastly, the DNA was purified using the QIAquick PCR purification Kit (Qiagen). CLASH : The RNA was incubated with 10 units of T4 PNK (NEB) in 3′ end RNA dephosphorylation buffer (50 mM imidazole-HCl pH 6.0, 10 mM MgCl2, 5 mM DTT, 40 units RNasin (Promega)) for 30 min at 37˚C. Following dephosphorylation, the RNA was purified using SPRI select beads according to the manufacturer's instructions. Dephosphorylated RNAs were ligated at their 3′ ends to a pre-adenylated DNA adaptor (AppNNNNTGGAATTCTCGGGTGCCAAGGddC) with 200 units of T4 RNA ligase 2 truncated KQ (NEB) in 3′ adaptor ligation buffer (1 ×T4 RNA ligase buffer, 15% PEG8000, 40 units RNasin (Promega)) overnight at 16˚C. 3′-ligation products were purified using SPRI select beads according to the manufacturer's instructions. The 5' ends of the RNAs were ligated to a 5′ RNA adaptor (GUUCAGAGUUCUACAGUCCGACGAUCNNNN) with 10 units of T4 RNA ligase 1 (NEB) in 5′ adaptor ligation buffer (1 ×T4 RNA ligase buffer, 1 mM ATP, 15% PEG8000, 40 units RNasin (Promega)) overnight at 16˚C. The RNA was subsequently purified using SPRI select beads according to the manufacturer's instructions. Isolated RNA was reverse-transcribed using Superscript III Reverse Transcriptase (invitrogen) and the RT primer (GCCTTGGCACCCGAGAATTCCA), according to the manufacturer's instructions. The cDNA was amplified using Illumina PR1 and RPI primers (TruSeq Small RNA kit) and the Q5 High-Fidelity DNA Polymerase (NEB), according to the manufacturer's instructions. PCR products were separated on a 6% polyacrylamide gel in 1 × TBE buffer and the gel stained with SYBR Gold Nucleic Acid Gel Stain (Life Technology). Gel slices containing amplified libraries (180 to 200 bp) were excised and homogenized in 0.4 M NaCl, followed by an incubation overnight at 4˚C on a rotor. PCR products were precipitated with ethanol and PelletPaint NF (Millipore). Lastly, the DNA pellets were washed with 70% ethanol and dissolved in Nuclease-Free Water. Libraries were sequenced on an Illumina HiSeq platform. CAGE : The 5 µg total RNAs from each replicate sample were reverse transcribed to cDNAs with random primers, and the capped RNA-cDNA hybrids were trapped by streptavidin beads. After the cap-trap, the single strand (ss)cDNAs were released from the beads and ligated to the Illumina Index containing a barcode identifier for each sample. Iso-seq : Total RNA was sequenced on a PacBio Sequel HiFi platform (Pacific Biosciences) by Macrogen Japan. Pacbio-DNAseq : The DNA was sequenced on a PacBio Sequel II HiFi platform (Pacific Biosciences) by Macrogen Japan. piRNA-seq : Library construction were performed using the NEXTflex small RNA-seq kit v3 (PerkinElmer) or following method. One μl of a 3' pre-adenylated adapter (20 pmol/μl) (AppNNNNTGGAATTCTCGGGTGCCAAGGddC) was added to 10.2 μl of purified RNA and incubated at 70°C for 2 min, followed by cooling to 4°C. The RNAs were then ligated to the adaptor at their 3′ ends in 3' ligation buffer (2 μl of 10 x T4 RNA ligase buffer (no ATP) (NEB), 4.8 μl of 50% PEG8000 (NEB), 1 μl of RNasin (Promega), 1 μl of T4 RNA ligase 2 truncated KQ (NEB)) at 16°C overnight (>16 h). The RNA was purified using SPRIselect beads (Beckman Coulter), eluted with 16 μl of Nuclease-Free Water, and the 3' adaptors degraded using deadenylase (NEB) and RecJf (NEB). After SPRIselect purification and elution with 8.2 μl of Nuclease-Free Water, the 5' adaptor ligation buffer (2 μl 10 x T4 RNA ligase Buffer (no ATP) (NEB), 2 μl of 10 mM ATP (NEB), 4.8 μl of 50% PEG8000 (NEB), 1 μl of 5' adaptor (20 pmol/μl) (GUUCAGAGUUCUACAGUCCGACGAUCNNNN), 1 μl of RNasin (Promega, N2111), 1 μl of T4 RNA ligase 1 (NEB, M0202L)) was added to the 3' ligated RNAs and incubated at 16°C overnight (>16 h). After SPRIselect purification and elution with 10.2 μl of Nuclease-Free Water, 2 μl of 10 μM RT primer (GCCTTGGCACCCGAGAATTCCA) was added and the RNA reverse-transcribed using SuperScript III (Invitrogen) according to the manufacturer's instructions. The libraries were amplified for 10 cycles using the Q5 High-Fidelity DNA polymerase (NEB), size selected by polyacrylamide gel electrophoresis and sequenced on the Illumina Miseq platform to obtain 50-nt single-end reads. ChIP-seq : Libraries were prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) according to the manufacturer's instructions.