Name: GSM7311097
Instrument: NextSeq 500
Strategy: RNA-Seq
Source: TRANSCRIPTOMIC
Selection: cDNA
Layout: PAIRED
Construction protocol: 1000 cells were cytofluorometrically sorted into 5ul TCL buffer (Qiagen) with 1% 2-mercaptoethanol (Sigma). Cells were double-sorted when cell numbers permitted. Total RNA was captured and purified on RNAClean XP beads (Beckman Coulter). Total RNA was captured and purified on RNAClean XP beads (Beckman Coulter). Polyadenylated mRNA was then selected using an anchored oligo(dT) primer (5′–AAGCAGTGGTATCAACGCAGAGTACT30VN-3) and converted to cDNA via reverse transcription. First-strand cDNA was subjected to limited PCR amplification followed by Tn5 transposon-based fragmentation using the Nextera XT DNA Library Preparation Kit (Illumina). Samples were then PCR amplified for 18 cycles using barcoded primers such that each sample carried a specific combination of eight-base Illumina P5 and P7 barcodes and were pooled together prior to Smart sequencing. Smart-seq paired-end sequencing was performed on an Illumina NextSeq500 using 2 x 38bp reads with no further trimming.