U.S. flag

An official website of the United States government

Format

Send to:

Choose Destination

SRX20264064: GSM7311097: 4aKO.4gKO.mTEChi.Thy#2; Mus musculus; RNA-Seq
1 ILLUMINA (NextSeq 500) run: 10.8M spots, 820.9M bases, 311.5Mb downloads

External Id: GSM7311097_r1
Submitted by: CBDM, Microbiology and Immunobiology, Harvard Medical School
Study: Hnf4 controls gut and liver gene programs in the thymus [bulk_RNAseq]
show Abstracthide Abstract
We profiled medullary thymic epithelial cells by bulk RNA-seq to investigate mechanisms of T-cell tolerance. Overall design: Bulk RNA-seq of mTECs
Sample: 4aKO.4gKO.mTEChi.Thy#2
SAMN35007909 • SRS17594305 • All experiments • All runs
Organism: Mus musculus
Library:
Name: GSM7311097
Instrument: NextSeq 500
Strategy: RNA-Seq
Source: TRANSCRIPTOMIC
Selection: cDNA
Layout: PAIRED
Construction protocol: 1000 cells were cytofluorometrically sorted into 5ul TCL buffer (Qiagen) with 1% 2-mercaptoethanol (Sigma). Cells were double-sorted when cell numbers permitted. Total RNA was captured and purified on RNAClean XP beads (Beckman Coulter). Total RNA was captured and purified on RNAClean XP beads (Beckman Coulter). Polyadenylated mRNA was then selected using an anchored oligo(dT) primer (5′–AAGCAGTGGTATCAACGCAGAGTACT30VN-3) and converted to cDNA via reverse transcription. First-strand cDNA was subjected to limited PCR amplification followed by Tn5 transposon-based fragmentation using the Nextera XT DNA Library Preparation Kit (Illumina). Samples were then PCR amplified for 18 cycles using barcoded primers such that each sample carried a specific combination of eight-base Illumina P5 and P7 barcodes and were pooled together prior to Smart sequencing. Smart-seq paired-end sequencing was performed on an Illumina NextSeq500 using 2 x 38bp reads with no further trimming.
Runs: 1 run, 10.8M spots, 820.9M bases, 311.5Mb
Run# of Spots# of BasesSizePublished
SRR2447847610,801,838820.9M311.5Mb2023-06-28

ID:
27684510

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...