U.S. flag

An official website of the United States government

Format

Send to:

Choose Destination

SRX1247367: GSM1881615: 2OMe-seq 1mM dNTPs (HeLa, Method #2); Homo sapiens; OTHER
1 ILLUMINA (NextSeq 500) run: 13.1M spots, 983M bases, 361.5Mb downloads

Submitted by: Gene Expression Omnibus (GEO)
Study: High-throughput single-base resolution mapping of 2'-O-Methylated residues
show Abstracthide Abstract
Functional characterization of the transcriptome requires tools for the systematic investigation of RNA post-transcriptional modifications. 2'-O-Methylation of the ribose moiety is one of the most abundant post-transcriptional modifications of the RNA. We describe here a high-throughput method that enables fast and accurate mapping at single-base resolution, and quantitation, of 2'-OMe modified residues. Our approach expands the actual repertoire of methods for transcriptome-wide mapping of RNA post-transcriptional modifications. Overall design: Mapping 2'-O-Methylated residues in Hela cells and E14 mouse embryonic stem cells.
Sample: 2OMe-seq 1mM dNTPs (HeLa, Method #2)
SAMN04088187 • SRS1070050 • All experiments • All runs
Organism: Homo sapiens
Library:
Instrument: NextSeq 500
Strategy: OTHER
Source: TRANSCRIPTOMIC
Selection: other
Layout: SINGLE
Construction protocol: Cells were washed twice in 1X PBS, and lysed by addition of 1ml ice-cold TRIzol (Invitrogen). RNA integrity measurements were performed using Fragment Analyzer™ (Advanced Analytical). All samples had RNA Quality Number (RQN) greater than 9.8. Briefly, 2 μg of total RNA were fragmented by addition of 5X First Strand Buffer (Invitrogen), and incubation at 95°C for 5 minutes. Fragmented RNA was purified on RNA Clean & Concentrator™-5 columns (Zymo Research). The eluted RNA was end repaired by adding 20U of T4 PNK (NEB), and incubating at 37°C for 1h, and then purified again on RNA Clean & Concentrator™-5 columns. A pre-adenylated (rApp) adapter (AGATCGGAAGAGCACACGTCT) was ligated to the end-repaired RNA fragments using 400U of T4 RNA Ligase 2, Deletion Mutant (Epicentre) in the presence of 20% PEG-8000, by incubating at 16°C for 18 hours. The day after, reactions were purified on RNeasy Micro Spin columns (Qiagen) to get rid of the excess adapter. Following cleanup, adapter-ligated RNA fragments were separated on a 10% TBE-Urea PAGE gel, and a gel slice corresponding to 200-250nt fragments was cut. RNA was recovered by passive diffusion in RNA Diffusion Buffer [450mM Ammonium Acetate, 0.05% SDS] for 16 hours at 4°C with end-to-end rotation. Following isopropanol precipitation, reverse transcription was performed in a 20 μl reaction, using 1mM final dNTPs (High dNTP sample), 0.5U/μl AMV Reverse Transcriptase (NEB), and an oligonucleotide complementary to the 3’ adapter (AGACGTGTGCTCTTCCGATCT). The reverse transcription reaction was conducted in 30 minutes at 42°C, followed by 10 minutes at 95°C to inactivate the AMV enzyme. Template RNA was degraded by addition of 1 μl of Ribonuclease H (Ambion), and 1 μl of RNase Cocktail Enzyme Mix (Ambion), followed by 30 minutes incubation at 37°C. cDNAs were purified on RNA Clean & Concentrator™-5 columns (Zymo Research), separated on a 10% TBE-Urea PAGE gel, and a gel slice corresponding to 50-150nt fragments (corresponding to truncated reverse transcription products) was cut. DNA was recovered by passive diffusion in TE Buffer [10mM Tris-HCl, 1mM EDTA] for 16 hours at 37°C with moderate shaking. Following ethanol precipitation, an adapter corresponding to the reverse complement of the standard Illumina TruSeq Small RNA 5’ Adapter (GATCGTCGGACTGTAGAACTCTGAAC), modified with a 5’-P group and a 3’-C3 spacer, was ligated to cDNAs 3’-OH termini using 200 U of CircLigase II for 6 hours at 65°C. The adapter-ligated cDNAs were then subjected to 18 cycles of PCR using standard Illumina TruSeq primers, and excess primers were removed using Agencourt Ampure XP beads. Libraries were pooled in equimolar amounts, and subjected to sequencing on the Illumina™ NextSeq 500 Sequencer.
Experiment attributes:
GEO Accession: GSM1881615
Links:
Runs: 1 run, 13.1M spots, 983M bases, 361.5Mb
Run# of Spots# of BasesSizePublished
SRR241408913,106,532983M361.5Mb2016-09-13

ID:
1794448

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...