Instrument: Illumina HiSeq 2000
Strategy: Bisulfite-Seq
Source: GENOMIC
Selection: RANDOM
Layout: PAIRED
Construction protocol: N/A for single cells and MII bulk as the BS treatment was performed on cell lysate. For 2i/serum bulk: DNA was purified from cell pellets using the QIAamp micro kit (QIAGEN), according to the manufacturer’s instructions. single cells: Bisulfite conversion was performed on cell lysates using the Imprint DNA Modification Kit (Sigma) with the following modifications: all volumes were halved, and chemical denaturation was followed by incubation at 65°C for 90min, 95°C for 3min and 65°C for 20min. Purification was performed as described previously (Miura et al., Nucleic Acids Research 40, e136–e136. 2012), and DNA eluted in 10mM Tris-Cl (pH 8.5) and combined with with 0.4mM dNTPs, 0.4µM oligo1 ([Btn]CTACACGACGCTCTTCCGATCTNNNNNNNNN) and 1x Blue Buffer (24µl final) before incubation at 65°C for 3min followed by 4°C pause. 50U of Klenow exo- (Sigma) was added and the samples were incubated at 4°C for 5min, +1°C/15s to 37°C, 37°C for 30min. Samples were incubated at 95°C for 1 min and transferred immediately to ice before addition of fresh oligo1 (10pmol), Klenow exo- (25U), and dNTPs (1nmol) in 2.5µl total. The samples were incubated at 4°C for 5min, +1°C/15s to 37°C, 37°C for 30min. This random priming and extension was repeated a further 3 times (5 repeats in total). Samples were then incubated with 40U exonuclease I (NEB) for 1h at 37°C before DNA was purified using 0.8x Agencourt Ampure XP beads (Beckman Coulter) according to the manufacturer’s guidelines. Samples were eluted in 10mM Tris-Cl (pH 8.5) and incubated with washed M-280 Streptavidin Dynabeads (Life Technologies) for 20min with rotation at room temperature. Beads were washed twice with 0.1N NaOH, and twice with 10mM Tris-Cl (pH 8.5) and re-suspended in 48µl of 0.4mM dNTPs, 0.4µM oligo2 (TGCTGAACCGCTCTTCCGATCTNNNNNNNNN) and 1x Blue Buffer. Samples were incubated at 95°C for 45s and transferred immediately to ice before addition of 100U Klenow exo- (Sigma) and incubation at 4°C for 5min, +1°C/15s to 37°C, 37°C for 90min. Beads were washed with 10mM Tris-Cl (pH 8.5) and resuspended in 50µl of 0.4mM dNTPs, 0.4µM PE1.0 forward primer AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT), 0.4µM indexed iPCRTag reverse primer (Quail et al. Nat Methods. 2011 9(1):10-1), 1U KAPA HiFI HotStart DNA Polymerase (KAPA Biosystems) in 1x HiFi Fidelity Buffer. Libraries were then amplified by PCR as follows: 95°C 2min, 12-13 repeats of (94°C 80s, 65°C 30s, 72°C 30s), 72°C 3min, 4°C hold. Amplified libraries were purified using 0.8x Agencourt Ampure XP beads, according to the manufacturer’s guidelines. bulk samples: Samples from bulk cell populations were prepared according to the protocol above, with the some modifications. For the bulk oocyte sample, 120 MII oocytes cells were collected and lysed as described above. For ESC bulk cell samples, DNA was purified from cell pellets using the QIAamp micro kit (QIAGEN), according to the manufacturer’s instructions, and 50ng of purified DNA was used in the library preparation. One round of first strand synthesis was performed using 0.8mM dNTPs and 4µM oligo1, and second strand synthesis also used 0.8mM dNTPs and 4µM oligo2. Bulk cell libraries were amplified as above with 9-12 cycles of PCR.