Format

Send to:

Choose Destination

SRX021027: VCU Vaginal Human Microbiome Project (VaHMP) Whole Metagenome Shotgun Sequencing
8 LS454 (454 GS FLX) runs: 369,320 spots, 211.6M bases, 427.5Mb downloads

Design: VCU-454RL-Protocol
Submitted by: Virginia Commonwealth University - Center for the Study of Biological Complexity (VCU-CSBC)
Study: The Vaginal Microbiome: Disease, Genetics and the Environment
show Abstracthide Abstract
This project will define the microbial composition of the human vagina, using state-of-the-art technologies that allow for the direct characterization and enumeration of the microorganisms present. Successful completion of the aims will define the relative contributions of genetics and the environment in the development and diversity of the vaginal microbial populations. Because the vaginal microbiota plays a crucial role in the urogenital tract health of females, evaluation of the factors that influence this first line of defense could lead to important therapies or intervention strategies for protecting women''s health.
Library:
Name: VCU_VAHMP_WMGS_exp1
Instrument: 454 GS FLX
Strategy: WGS
Source: METAGENOMIC
Selection: RANDOM
Layout: SINGLE
Spot descriptor:
          barcode
Group tagBasecalls
GCSDRXG01_ACGACACGTATACGACACGTAT
GCSDRXG01_ACGAGTAGACTACGAGTAGACT
GCSDRXG02_ACGCGTCTAGTACGCGTCTAGT
GCSDRXG02_ACGTACACACTACGTACACACT
GFLQUDJ01_ACACGACGACTACACGACGACT
GFLQUDJ01_ACACGTAGTATACACGTAGTAT
GFLQUDJ02_ACACTACTCGTACACTACTCGT
GFLQUDJ02_ACGACACGTATACGACACGTAT
  forward

Runs: 8 runs, 369,320 spots, 211.6M bases, 427.5Mb
Run# of Spots# of BasesSizePublished
SRR04966417,66010.5M18.5Mb2010-06-21
SRR049666140,53178.1M168.9Mb2010-06-21
SRR04966799,36554.4M119.3Mb2010-06-21
SRR04966836,35522.1M41.8Mb2010-06-21
SRR04966943,40825.9M49.8Mb2010-06-21
SRR0496707,9785.3M6.9Mb2010-06-21
SRR04967115,41810.3M13.5Mb2010-06-21
SRR0496658,6055.1M8.8Mb2010-06-21

#Member# of Spots# of Bases
1SRS068447 : 2010_04_14_2VT15,41810.3M
2SRS068451 : 2010_04_14_2VB7,9785.3M
3SRS068850 : 2010_04_14_1VB36,35522.1M
4SRS068855 : 2010_04_14_1VT43,40825.9M
5SRS069331 : 2010_02_23_1VT8,6055.1M
6SRS069333 : 2010_02_23_1VB17,66010.5M
7SRS069940 : 2010_02_23_2VT99,36554.4M
8SRS069944 : 2010_02_23_2VB140,53178.1M
9 : defaultn/an/a

ID:
22543

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center