Format

Send to:

Choose Destination

SRX142115: polyA RNA sequencing of H1 cells
1 ILLUMINA (Illumina HiSeq 2000) run: 202.3M spots, 40.9G bases, 25.9Gb downloads

Design: Four µg of total RNA was extracted from frozen cell pellets using the RNeasy Mini Kit (Qiagen, Valencia, CA). PolyA RNA was isolated from total RNA using Dynabeads oligo(dt)25 (Invitrogen). PolyA selected RNA was eluted in 2x Superscript III buffer supplemented with 10mM DTT and was fragmented by incubation at 94°C for 4 minutes. First-strand cDNA was synthesized with the following reaction composition: 0.5 µL random hexamer, 0.5 µL RNase Out, 1 µL DTT (100 mM), 0.5 µL dNTP (25 mM), 0.5 µL SuperScript III (20 µL final). The reaction was incubated at 25°C for 10 min then 50°C for 50 min. Single-stranded cDNA was isolated by purification with RNAClean XP beads (Beckman Coulter Genomics, Danvers, MA). The dUTP-containing second-strand was synthesized with the following reaction: 1.5 µL NEBuffer 2 (NEB), 1 µL dNTP mix (10 mM dATP, dCTP, dGTP, and dUTP), 0.2 µL RNase H, 1 µL DNA Polymerase I (E. coli) (New England Biolabs) (15 µL final). The reaction was incubated at 16°C for 2.5 hours. The dUTP-containing cDNA was isolated by purification with AMPure XP beads (Beckman Coulter Genomics, Danvers, MA). The dUTP-containing cDNA was then end repaired and a 3' A base was added. TruSeq adapters (Illumina, San Diego, CA) were ligated to the dUTP-containing cDNA at 16°C for 16 hours with T4 DNA ligase (New England Biolabs). Adapter-ligated cDNA was isolated by two rounds of purification with AMPure XP beads. The dUTP-containing strands were digested at 37°C for 30 min with uracil DNA glycosylase (Enzymatics). Adapter-ligated, single-stranded DNA molecules were enriched by 10 cycles of PCR with the following reaction composition: 5 µL TruSeq PCR Primer Cocktail (Illumina), 25 µL TruSeq PCR Master Mix (Illumina) (50 µL final). The thermocycling parameters were: 98°C 30 sec, then 10-15 cycles of 98°C 10 sec, 60°C 30 sec and 72°C 30 sec, ending with one 72°C 5 min step. The reaction products were purified using AMPure XP beads.
Submitted by: Gene Expression Omnibus (GEO)
Study: UCSD Human Reference Epigenome Mapping Project
show Abstracthide Abstract
The human embryonic stem cells (hESCs) are a unique model system for investigating the mechanisms of human development due to their ability to replicate indefinitely while retaining the capacity to differentiate into a host of functionally distinct cell types. In addition, these cells could be potentially used as therapeutic agents in regenerative medicine. Differentiation of hESCs involves selective activation or silencing of genes, a process controlled in part by the epigenetic state of the cell. In order to gain a better understanding of the epigenetic mechanisms regulating differentiation of hESCs, and produce general reference epigenome maps of the human cells, we propose to establish an Epigenome Center in San Diego. Our center will be focused on both undifferentiated hESC and four hESC-derived early embryonic cell lineages including extraembryonic endoderm, trophoblast, mesendoderm (a common precursor to mesodermal and endodermal lineages), and mesenchymal cells (a specific mesoderm derivative). We have developed and validated high throughput technologies for mapping the state of DNA methylation and chromatin modifications throughout the genome, and will use these methods to generate high-resolution maps of the reference epigenomes. Specifically, we will grow and differentiate hESCs into multiple lineages, and map DNA methylation sites using a newly developed technology that combines bisulfite conversion and whole genome shotgun sequencing. We will also determine the histone modification status in the genome by performing both ChlP-chip and ChlP-Seq analysis. We will develop advanced statistical and algorithmic solutions to facilitate high-throughput sequencing data analysis, and establish an informatics pipeline for collecting, storage, and distribution of epigenome maps. Finally, we will perform integrated data analysis to identify new epigenetic patterns in the genome that could provide insights in mechanisms of epigenetic regulation.
Sample: Generic sample from Homo sapiens
SAMN00855416 • SRS309367 • All experiments • All runs
Organism: Homo sapiens
Library:
Name: polyA-RNA-seq_h1_r1a
Instrument: Illumina HiSeq 2000
Strategy: RNA-Seq
Source: TRANSCRIPTOMIC
Selection: cDNA
Layout: PAIRED
Spot descriptor:
forward102  forward

Experiment attributes: (show all 29 attributes...) (hide...)
EXPERIMENT_TYPE: mRNA-Seq
EXTRACTION_PROTOCOL: Qiagen RNeasy mini kit, performed as per manufactu (show full text...)(hide...)
Qiagen RNeasy mini kit, performed as per manufacturer's instructions
CDNA_PREPARATION_INITIAL_RNA_QNTY: 4 µg
CDNA_PREPARATION_POLYA_RNA/: Dynabeads oligo(dt)25 (Invitrogen)
CDNA_PREPARATION_FRAGMENTATION: PolyA RNA resuspended in 2x Superscript III buffer (show full text...)(hide...)
PolyA RNA resuspended in 2x Superscript III buffer supplemented with 10 mM DTT was incubated at 94°C for 4 min
CDNA_PREPARATION_FRAGMENT_SIZE_RANGE: 200-250
CDNA_PREPARATION_FIRST_STRAND_SYNTHESIS_ENZYME: SuperScript III (Invitrogen)
CDNA_PREPARATION_FIRST_STRAND_PURIFICATION: Purification with RNAClean XP beads (Agencourt)
CDNA_PREPARATION_SECOND_STRAND_SYNTHESIS_ENZYME: DNA Polymerase I (E. coli) (New England Biolabs)
CDNA_PREPARATION_SECOND_STRAND_SYNTHESIS_DNTP_MIX: dNTP mix made from 10 mM dATP, dCTP, dGTP, dUTP
CDNA_PREPARATION_PURIFICATION: Purification with AMPure XP beads (Agencourt)
DNA_PREPARATION_ADAPTOR: TruSeq Multiplexed Adapters (Illumina)
DNA_PREPARATION_ADAPTOR_LIGATION_PROTOCOL: 16°C for 16 hours with T4 DNA ligase (New England (show full text...)(hide...)
16°C for 16 hours with T4 DNA ligase (New England Biolabs)
DNA_PREPARATION_POST-LIGATION_FRAGMENT_SIZE_SELECTION: Two rounds of purification with AMPure XP beads (A (show full text...)(hide...)
Two rounds of purification with AMPure XP beads (Agencourt)
DNA_PREPARATION_URACIL_DNA_GLYCOSYLASE_DIGESTION: One half of adapter-ligated cDNA digested with ura (show full text...)(hide...)
One half of adapter-ligated cDNA digested with uracil DNA glycosylase (Enzymatics) and used for subsequent steps.
LIBRARY_GENERATION_PCR_POLYMERASE_TYPE: TruSeq PCR Master Mix (Illumina)
LIBRARY_GENERATION_PCR_THERMOCYCLING_PROGRAM: 98°C 30 sec; 10 cycles of 98°C 10 sec, 60°C 30 sec (show full text...)(hide...)
98°C 30 sec; 10 cycles of 98°C 10 sec, 60°C 30 sec, 72°C 30 sec; 72°C 10 min
LIBRARY_GENERATION_PCR_NUMBER_CYCLES: 10
LIBRARY_GENERATION_PCR_PRIMER: TruSeq PCR Primer Cocktail (Illumina)
LIBRARY_GENERATION_PCR_PRODUCT_ISOLATION_PROTOCOL: Purification with AMPure XP beads (Agencourt)
EXTRACTION_PROTOCOL_MRNA_ENRICHMENT: Dynabeads oligo(dt)25 protocol
RNA_PREPARATION_REVERSE_TRANSCRIPTION_PRIMER_SEQUENCE: Random hexamers
RNA_PREPARATION_REVERSE_TRANSCRIPTION_PROTOCOL: First-strand Superscript III (Invitrogen) RT proto (show full text...)(hide...)
First-strand Superscript III (Invitrogen) RT protocol. RNAClean XP purification of first strand product. Second-strand synthesis using dUTP-containing dNTPS and DNA Polymerase 1 (E. coli) (New England Biolabs)
LIBRARY_GENERATION_PCR_TEMPLATE: cDNA
LIBRARY_GENERATION_PCR_TEMPLATE_CONC: 5 ng/µL
LIBRARY_GENERATION_PCR_F_PRIMER_SEQUENCE: 5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGC (show full text...)(hide...)
5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC 3'
LIBRARY_GENERATION_PCR_R_PRIMER_SEQUENCE: 5' CAAGCAGAAGACGGCATACGAGAT 3'
LIBRARY_GENERATION_PCR_PRIMER_CONC: 200nM
GEO Accession: GSM915328
Pipeline: show...hide...
NameStepPrev StepProgramVersion
BASE_CALLS1NILRTA1.12.4.2
QUALITY_SCORES21RTA1.12.4.2
Links:
External link:
External link:
Runs: 1 run, 202.3M spots, 40.9G bases, 25.9Gb
Run# of Spots# of BasesSizePublished
SRR488684202,255,24040.9G25.9Gb2012-04-18

ID:
171806

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center