U.S. flag

An official website of the United States government

Format

Send to:

Choose Destination

SRX1160173: ITS2 sequences from soils in the Maritime Antarctic
1 LS454 (454 GS FLX Titanium) run: 1.7M spots, 484.6M bases, 267.6Mb downloads

Submitted by: THE UNIVERSITY OF QUEENSLAND
Study: Maritime Antarctic soil fungi Targeted Locus (Loci)
show Abstracthide Abstract
Terrestrial environments in the Maritime Antarctic are among the most rapidly warming ecosystems on Earth. Here we use 454 sequencing of ITS2 amplicons to characterise the diversity of soil fungal communities. We then relate patterns of diversity to a range of abiotic factors to determine the drivers of fungal diversity.
Sample: Total DNA was extracted under sterile conditions from 10 g of soil using a PowerMax Soil DNA isolation kit (MO BIO). ITS2 regions were PCR amplified using the primers gITS7 (5 GTGARTCATCGARTCTTTG) and ITS4 (5 TCCTCCGCTTATTGATATGC). The ITS4 primer was 5-labelled with a sample specific MID. site_1_Mars Oasis 1, Alexander Island;__lat_long_71.878 S 68.248 W;__alt_15;__MID_CTGCGC; site_2_Mars Oasis 2, Alexander Island;__lat_long_71.878 S 68.248 W;__alt_15;__MID_CTGTAC; site_3_Mars Oasis 3, Alexander Island;__lat_long_71.878 S 68.248 W;__alt_15;__MID_TACTGC; site_4_Mars Oasis 4, Alexander Island;__lat_long_71.878 S 68.248 W;__alt_15;__MID_TAGCGC; site_5_Mount Holt, Alexander Island;__lat_long_69.408 S 71.665 W;__alt_70;__MID_ACAGC; site_6_Hopkins Ridge 1, Alexander Island;__lat_long_69.368 S 71.844 W;__alt_62;__MID_TACAT; site_7_Hopkins Ridge 2, Alexander Island;__lat_long_69.367 S 71.844 W;__alt_62;__MID_CGCAT; site_8_Hopkins Ridge 3, Alexander Island;__lat_long_69.366 S 71.842 W;__alt_66;__MID_CTAGT; site_9_Hop
SAMN03944745 • SRS1041156 • All experiments • All runs
Organism: soil metagenome
Library:
Instrument: 454 GS FLX Titanium
Strategy: AMPLICON
Source: METAGENOMIC
Selection: PCR
Layout: SINGLE
Spot descriptor:
         forward

Runs: 1 run, 1.7M spots, 484.6M bases, 267.6Mb
Run# of Spots# of BasesSizePublished
SRR21758011,697,384484.6M267.6Mb2016-08-20

ID:
1686941

Supplemental Content

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center