Format

Send to:

Choose Destination

SRX753160: GSM1539876: RNAseq_RAMOS_rep3; Homo sapiens; RNA-Seq
1 ILLUMINA (Illumina HiSeq 2500) run: 18.9M spots, 945.6M bases, 659.6Mb downloads

Submitted by: Gene Expression Omnibus (GEO)
Study: B cell super-enhancers and regulatory clusters recruit AID tumorigenic activity
show Abstracthide Abstract
The antibody gene mutator AID promiscuously damages oncogenes and B cell identity genes leading to chromosomal translocations and tumorigenesis. Why non-immunoglobulin loci are susceptible to AID activity is unknown. Here we study AID-mediated lesions in the context of nuclear architecture and the B cell regulome. We show that AID targets are not randomly distributed across the genome, but are predominantly clustered within super-enhancers. Unexpectedly, in these domains AID deaminates highly active promoters and eRNA+ enhancers interconnected in some instances over megabases of linear chromatin. Using genome editing we demonstrate that 3D-linked targets cooperate to recruit AID-mediated breaks. Furthermore, a comparison of hypermutation in mouse B cells, AID-induced kataegis in human lymphomas, and translocations in MEFs reveals that AID damages different genes in different cell types. Yet, in all cases, the targets are predominantly associated with topological complex, highly transcribed super-enhancers, demonstrating that these compartments are key mediators of AID recruitment. Overall design: Examination of AID activity in human cells via Single Nucleotide Variant discovery in H3K4me3 ChIP-seq data from 26 MSH2-/-; AIDtg; UGItg, 18 AICDA-/- and 2 unmodified RAMOS clonal populations. Examination of PolII mediated long-range interactions via Chia-PET of RAMOS cells (2 sample). Identification of super-enhancers from H3K27Ac ChIP-Seq data from activated B cells (3 replicates and 1 input control) and RAMOS cells (1 sample and 1 input control), 2 preparations of naive and 2 of germinal center (GC) B cells from human tonsilectomy samples. Mapping of regulatory elements in RAMOS based on H3K4me1 (1 sample) and Nipbl (2 replicates) ChIP-Seq. RNA expression analyses of activated B cells from 3 WT and 3 Il4raU/U mice and RAMOS cells (3 replicates). Mapping of long-range interactions by 4C in activated B cells from a WT and an Il4raU/U mouse with the IL4ra and Il21r locus, respectively, as a viewpoint. Mapping of Super-Enhancers in activated B cells from Il4raU/U and WT control mice (2 samples).
Sample: RNAseq_RAMOS_rep3
SAMN03166078 • SRS738610 • All experiments • All runs
Organism: Homo sapiens
Library:
Instrument: Illumina HiSeq 2500
Strategy: RNA-Seq
Source: TRANSCRIPTOMIC
Selection: cDNA
Layout: SINGLE
Construction protocol: ChIP-Seq: Cultured cells were fixed with 1% formaldehyde (Sigma) for 10’ at 37°C. Fixation was quenched by addition of glycine (Sigma) at a final concentration of 125 mM. Twenty million fixed cells were washed with PBS and resuspended in 1 ml of RIPA buffer (10 mM Tris [pH 7.6], 1 mM EDTA, 0.1% SDS, 0.1% sodium deoxycholate, 1% Triton X-100, 1× Complete Mini EDTA free proteinase inhibitor (Roche)) or stored at −80°C until further processing. Sonication was performed using Covaris S2 sonicator at duty cycle 20%, intensity 5, cycle/burst 200 for 30 min or Branson sonifier at amplitude 35%, 12 cycles of 20” sonication and 30” of pause. For native chip, chromatin was digested with Mnase (Sigma) in digestion buffer (50 mM Tris-HCl, pH7.6, 1 mM CaCl2, 0.2% Triton X-100, butyrate 5 mM) for 5’ at 37°C and dialyzed against RIPA buffer for 2hrs at 4°C. Five micrograms of antibody were incubated with 40 μl of Dynabeads Protein A (or G) for 40 min at room temperature. Antibody-bound beads were added to 500 μl of sonicated or Mnase-digested chromatin, incubated at 4°C overnight, and washed twice with RIPA buffer, twice with RIPA buffer containing 0.3M NaCl, twice with LiCl buffer (0.25 M LiCl, 0.5% Igepal-630, 0.5% sodium deoxycholate), once with TE (pH 8.0) plus 0.2% Triton X-100, and once with TE (pH 8.0). Crosslinking was reversed by incubating the beads at 65°C for 4 hr in the presence of 0.3% SDS and 1 mg/ml Proteinase K. ChIP DNA was purified by phenol-chloroform extraction followed by ethanol precipitation. RNA-Seq: Total RNA from 1e6 activated B cells was isolated by Trizol extraction. 4C-Seq: Ten million mouse B cells were crosslinked in 2% formaldehyde at room temperature for 10 min. The reaction was quenched by the addition of glycine (final concentration of 0.125 M). Cells were then washed with cold PBS and lysed (10 mM Tris-HCl, pH 8.0, 10 mM NaCl, 0.2% NP-40, 1× complete protease inhibitors (Roche)) at 4 °C for 1 h. Nuclei were incubated at 65 °C for 30 min, 37 °C for 30 min in 500 μl of restriction buffer (New England Biolabs DpnII buffer) containing 0.3% SDS. To sequester SDS, Triton X-100 was then added to a final concentration of 1.8%. DNA digestion was performed with 400 U of DpnII (New England Biolabs) at 37 °C overnight. After heat inactivation (65 °C for 30 min), the reaction was diluted to a final volume of 7 ml with ligation buffer containing 100 U T4 DNA Ligase (Roche) and incubated at 16 °C overnight. Samples were then treated with 500 μg Proteinase K (Ambion) and incubated overnight at 65 °C to reverse formaldehyde crosslinking. DNA was then purified by phenol extraction and ethanol precipitation. For circularization, the ligation junctions were digested with Csp6I (Fermentas) at 37 °C overnight. After enzyme inactivation and phenol extraction, the DNA was religated in a 7-ml volume (1,000 U T4 DNA Ligase, Roche). Three micrograms of 4C library DNA was amplified with Expand Long template PCR System (Roche). Thermal cycle conditions were DNA denaturing for 2 min at 94 °C, followed by 30 cycles of 15 s at 94 °C, 1 min at 58 °C, 3 min at 68 °C, and a final step of 7 min at 68 °C. Baits were amplified with inverse PCR primers as follows: Il4ra with DpnII_4C 5′-TCAGGTAGTTCCATGGGATC-3′, Il4ra_Csp6i 5′-ATCTCTGCACCAGACATCAG-3, IL21r_DpnII: CCAGACCTACTTAGCAGATC, and IL21r_Csp6i: ACTTAGACACTGCTCAGCTG. ChIA-PET: RNA PolII ChIA-PET was performed as previously described (Fullwood et al., 2009, Goh et al., 2012 and Li et al., 2012). Briefly, RAMOS cells (up to 3e9 cells) were treated with 1% formaldehyde at room temperature for 10 min and then neutralized using 0.2 M glycine. The crosslinked chromatin was subjected to fragmentation with an average length of 300 bp by sonication. The anti-PolII monoclonal antibody 8WG16 (Covance, MMS-126R) was used to enrich PolII-bound chromatin fragments. A portion of ChIP DNA was eluted off from antibody-coated beads for concentration quantification using Picogreen fluorimetry and for enrichment analysis using quantitative PCR. ChIP-Seq and 4C: DNA was blunt-ended with End-It DNA end repair kit (Epicenter) and A-tailed with Taq DNA polymerase (Invitrogen) in the presence of 200mM of dATP for 40 min at 70°C. Samples were purified by phenol-chloroform extraction after each reaction. Illumina compatible adaptors (Bioo Scientific) were then ligated with T4 DNA ligase (Enzymatics), and the reaction was purified once with AMpure XP magnetic beads (Beckman Coulter). Samples were PCR amplified for 12~15 cycles with KAPA HiFi DNA polymerase mix (KAPA Biosystems) and run on a 2% agarose gel and size-selected at 250–350 bp. 50 cycles of sequencing data were acquired on the HiSeq 2000 or 2500 (Illumina). RNA-Seq: Standard RNA-Seq library preparation was performed following Illumina’s RNA-Seq protocol v2. ChIA-PET: For ChIA-PET library construction ChIP DNA fragments from two biological replicates were end-repaired using T4 DNA polymerase (NEB) and ligated to either linker A or linker B. Other than four nucleotides in the middle of the linkers that were used as nucleotide barcode, the two linkers share the same nucleotide sequences. After linker ligation, the two samples were combined for proximity ligation in diluted conditions. During the proximity ligation, DNA fragments within the same ChIP complex with the same linker were ligated, which generated the ligation products with homodimer linker composition. However, chimeric ligations between ChIP fragments that are bound in different chromatin complexes could also occur, thus producing ligation products with heterodimer linker composition. Following proximity ligation, the Paired-End-Tag (PET) constructs were extracted from the ligation products and the PET templates were subjected to paired-end sequencing using Illumina HiSeq.
Experiment attributes:
GEO Accession: GSM1539876
Links:
External link:
Runs: 1 run, 18.9M spots, 945.6M bases, 659.6Mb
Run# of Spots# of BasesSizePublished
SRR164381618,911,816945.6M659.6Mb2014-12-05

ID:
1089819

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center