Format

Send to:

Choose Destination

SRX359335: RNA extracted from HeLa cells. Cells were purchased from ATCC and cultured as indicated
1 ILLUMINA (Illumina HiSeq 2000) run: 38.4M spots, 2G bases, 1.2Gb downloads

Design: Total RNA is isolated using Tri-reagent (Ambion) and DNase-treated (Ambion). An oligo(dT) primer containing a VN-anker, a uridine, the sequence of the sequencing adapter and biotin (/5BiosG/CAGACGTGTGCTCTTCCGATCTTTTTTTTrUTTTTTTTTVN) is attached to streptavidin-coated magnetic beads (M280, Invitrogen). Total RNA is incubated for 5 min at 65°C, followed by incubation with the coated magnetic beads for 10 min at 45°C. First strand synthesis is carried out using Superscript III reverse transcriptase (Invitrogen) at 50°C. The enzyme is inactivated by incubation at 70°C for 15 min. Second strand synthesis is carried out using Second stand synthesis buffer (Invitrogen), dNTPs, DNA polymerase I (NEB), E. coli ligase (NEB) and RNase H (Invitrogen). To exchange the buffers and to remove enzymes from the previous step, we treat the samples with Pronase (Roche). We introduce a nick at the position of the uridine with RNAse HII (NEB). Then, nick translation is carried out with DNA polymerase I (NEB) and dNTPs for 8 min at 8°C. The reaction is stopped by the addition of EDTA. At the new position of the nick we create a blunt end using T7 exonuclease, mung bean nuclease (NEB) and Klenow enzyme (NEB). Previously annealed Illumina truseq sequencing adapters (Ad1: 5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT; Ad2: 5'- AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTAT) are then blunt- end ligated. The magnetic beads are suspended in 39 ul H2O. 5 ul of beads are used in a PCR reaction. 10-13 cycles of PCR are carried out with Phusion polymerase (NEB), a forward primer (5'-AATGATACGGCGACCACCGAGATC) and one of the Illumina truseq barcode reverse primers. For preparation of the library 6 PCR reactions are performed, run on 8% TBE gels (Invitrogen) and the smear between 160 bp and 220 bp is cut out, gel-extracted, ethanol-precipitated, analyzed by Bioanalyzer (Agilent) and sequenced on Illumina Hi-seq machines. A detailed protocol of 3'-seq will be available at the author's webpage.
Submitted by: MEMORIAL SLOAN-KETTERING CANCER CENTER
Study: Homo sapiens strain:Several cell lines and primary RNA Targeted Locus (Loci)
show Abstracthide Abstract
More than half of human genes use alternative cleavage and polyadenylation (ApA) to generate mRNA transcripts that differ in the length of their 3' untranslated region (3'UTR), thus altering the post-transcriptional fate of the message and hence the protein output. The extent of 3'UTR variation across tissues and the functional role of ApA remain poorly understood. We developed a sequencing method to quantitatively map the 3' ends of the transcriptome of diverse human tissues and isogenic transformation systems. We found that cell type-specific gene expression is accomplished by two complementary programs. Tissue-restricted genes tend to have single 3'UTRs whereas a majority of ubiquitously transcribed genes generate multiple 3'UTRs. During transformation and differentiation, single-UTR genes change their mRNA abundance levels while multi-UTR genes mostly change 3'UTR isoform ratios to achieve tissue-specificity. However, both regulation programs target genes that function in the same pathways and processes that characterize the new cell type. Instead of finding global shifts in 3'UTR length during transformation and differentiation, we identify tissue-specific groups of multi-UTR genes that change their 3'UTR ratios – these changes in 3'UTR length are largely independent from changes in mRNA abundance. Finally, tissue-specific usage of ApA sites appears to be mechanism for changing the landscape targetable by ubiquitously expressed microRNAs.
Sample: HeLa cell line
SAMN02356476 • SRS486990 • All experiments • All runs
Organism: Homo sapiens
Library:
Name: hela_1
Instrument: Illumina HiSeq 2000
Strategy: RNA-Seq
Source: TRANSCRIPTOMIC
Selection: other
Layout: SINGLE
Spot descriptor:
forward

Runs: 1 run, 38.4M spots, 2G bases, 1.2Gb
Run# of Spots# of BasesSizePublished
SRR100560538,382,8232G1.2Gb2013-10-08

ID:
507636

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center