Display Settings:

Format
Sort by

Send to:

Choose Destination

Search results

Items: 2

1.

rs56107638 [Homo sapiens]
    ACCAGTGGCAGGTCAACCATGACCC[A/G]TGAGTACATACCCCTCACGAAAAAA
    Chromosome:
    15:74753271
    Gene:
    CYP1A2 (GeneView)
    Functional Consequence:
    splice donor variant
    Validated:
    by cluster,by frequency
    HGVS:
    CM000677.2:g.74753271G>A, NC_000015.10:g.74753271G>A, NC_000015.9:g.75045612G>A, NC_000015.9:g.75045612G>C, NG_008431.2:g.35730G>A, NG_008431.2:g.35730G>C, NM_000761.4:c.1253+1G>A, NM_000761.4:c.1253+1G>C
    2.

    rs57702151 has merged into rs56107638 [Homo sapiens]
      ACCAGTGGCAGGTCAACCATGACCC[A/G]TGAGTACATACCCCTCACGAAAAAA
      Chromosome:
      15:74753271
      Gene:
      CYP1A2 (GeneView)
      Functional Consequence:
      splice donor variant
      Validated:
      by cluster,by frequency
      HGVS:
      CM000677.2:g.74753271G>A, NC_000015.10:g.74753271G>A, NC_000015.9:g.75045612G>A, NC_000015.9:g.75045612G>C, NG_008431.2:g.35730G>A, NG_008431.2:g.35730G>C, NM_000761.4:c.1253+1G>A, NM_000761.4:c.1253+1G>C

      Supplemental Content

      Find related data

      Search details

      See more...

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center