Display Settings:

Format
Sort by

Send to:

Choose Destination

Search results

Items: 3

1.

rs1801280 [Homo sapiens]
    GTTCACCTTCTCCTGCAGGTGACCA[C/T]TGACGGCAGGAATTACATTGTCGAT
    Chromosome:
    8:18400344
    Gene:
    NAT2 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    T(germline)/C(germline)
    Clinical significance:
    drug-response
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    C=0.2927/1466
    HGVS:
    CM000670.2:g.18400344T>C, NC_000008.10:g.18257854T>C, NC_000008.11:g.18400344T>C, NG_012246.1:g.14100T>C, NM_000015.2:c.341T>C, NP_000006.2:p.Ile114Thr, XP_016868427.1:p.Ile114Thr
    2.

    rs4134724 has merged into rs1801280 [Homo sapiens]
      GTTCACCTTCTCCTGCAGGTGACCA[C/T]TGACGGCAGGAATTACATTGTCGAT
      Chromosome:
      8:18400344
      Gene:
      NAT2 (GeneView)
      Functional Consequence:
      missense
      Allele Origin:
      T(germline)/C(germline)
      Clinical significance:
      drug-response
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      C=0.2927/1466
      HGVS:
      CM000670.2:g.18400344T>C, NC_000008.10:g.18257854T>C, NC_000008.11:g.18400344T>C, NG_012246.1:g.14100T>C, NM_000015.2:c.341T>C, NP_000006.2:p.Ile114Thr, XP_016868427.1:p.Ile114Thr
      3.

      rs56935242 has merged into rs1801280 [Homo sapiens]
        GTTCACCTTCTCCTGCAGGTGACCA[C/T]TGACGGCAGGAATTACATTGTCGAT
        Chromosome:
        8:18400344
        Gene:
        NAT2 (GeneView)
        Functional Consequence:
        missense
        Allele Origin:
        T(germline)/C(germline)
        Clinical significance:
        drug-response
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        C=0.2927/1466
        HGVS:
        CM000670.2:g.18400344T>C, NC_000008.10:g.18257854T>C, NC_000008.11:g.18400344T>C, NG_012246.1:g.14100T>C, NM_000015.2:c.341T>C, NP_000006.2:p.Ile114Thr, XP_016868427.1:p.Ile114Thr

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Search details

        See more...

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center