Display Settings:

Format
Sort by

Send to:

Choose Destination

Search results

Items: 5

1.

rs1799931 [Homo sapiens]
    AATCTCGTGCCCAAACCTGGTGATG[A/G]ATCCCTTACTATTTAGAATAAGGAA
    Chromosome:
    8:18400860
    Gene:
    NAT2 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    drug-response
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    A=0.0773/387
    HGVS:
    CM000670.2:g.18400860G>A, NC_000008.10:g.18258370G>A, NC_000008.11:g.18400860G>A, NG_012246.1:g.14616G>A, NM_000015.2:c.857G>A, NP_000006.2:p.Gly286Glu, XP_016868427.1:p.Gly286Glu
    2.

    rs4646270 has merged into rs1799931 [Homo sapiens]
      AATCTCGTGCCCAAACCTGGTGATG[A/G]ATCCCTTACTATTTAGAATAAGGAA
      Chromosome:
      8:18400860
      Gene:
      NAT2 (GeneView)
      Functional Consequence:
      missense
      Allele Origin:
      G(germline)/A(germline)
      Clinical significance:
      drug-response
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      A=0.0773/387
      HGVS:
      CM000670.2:g.18400860G>A, NC_000008.10:g.18258370G>A, NC_000008.11:g.18400860G>A, NG_012246.1:g.14616G>A, NM_000015.2:c.857G>A, NP_000006.2:p.Gly286Glu, XP_016868427.1:p.Gly286Glu
      3.

      rs17693862 has merged into rs1799931 [Homo sapiens]
        AATCTCGTGCCCAAACCTGGTGATG[A/G]ATCCCTTACTATTTAGAATAAGGAA
        Chromosome:
        8:18400860
        Gene:
        NAT2 (GeneView)
        Functional Consequence:
        missense
        Allele Origin:
        G(germline)/A(germline)
        Clinical significance:
        drug-response
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        A=0.0773/387
        HGVS:
        CM000670.2:g.18400860G>A, NC_000008.10:g.18258370G>A, NC_000008.11:g.18400860G>A, NG_012246.1:g.14616G>A, NM_000015.2:c.857G>A, NP_000006.2:p.Gly286Glu, XP_016868427.1:p.Gly286Glu
        4.

        rs52802193 has merged into rs1799931 [Homo sapiens]
          AATCTCGTGCCCAAACCTGGTGATG[A/G]ATCCCTTACTATTTAGAATAAGGAA
          Chromosome:
          8:18400860
          Gene:
          NAT2 (GeneView)
          Functional Consequence:
          missense
          Allele Origin:
          G(germline)/A(germline)
          Clinical significance:
          drug-response
          Validated:
          by 1000G,by cluster,by frequency
          Global MAF:
          A=0.0773/387
          HGVS:
          CM000670.2:g.18400860G>A, NC_000008.10:g.18258370G>A, NC_000008.11:g.18400860G>A, NG_012246.1:g.14616G>A, NM_000015.2:c.857G>A, NP_000006.2:p.Gly286Glu, XP_016868427.1:p.Gly286Glu
          5.

          rs58803786 has merged into rs1799931 [Homo sapiens]
            AATCTCGTGCCCAAACCTGGTGATG[A/G]ATCCCTTACTATTTAGAATAAGGAA
            Chromosome:
            8:18400860
            Gene:
            NAT2 (GeneView)
            Functional Consequence:
            missense
            Allele Origin:
            G(germline)/A(germline)
            Clinical significance:
            drug-response
            Validated:
            by 1000G,by cluster,by frequency
            Global MAF:
            A=0.0773/387
            HGVS:
            CM000670.2:g.18400860G>A, NC_000008.10:g.18258370G>A, NC_000008.11:g.18400860G>A, NG_012246.1:g.14616G>A, NM_000015.2:c.857G>A, NP_000006.2:p.Gly286Glu, XP_016868427.1:p.Gly286Glu

            Display Settings:

            Format
            Sort by

            Send to:

            Choose Destination

            Supplemental Content

            Find related data

            Search details

            See more...

            Recent activity

            Your browsing activity is empty.

            Activity recording is turned off.

            Turn recording back on

            See more...
            Support Center