Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Search results

Items: 6

1.

rs1799930 [Homo sapiens]
    ATATACTTATTTACGCTTGAACCTC[A/G]AACAATTGAAGATTTTGAGTCTATG
    Chromosome:
    8:18400593
    Gene:
    NAT2 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    drug-response
    Validated:
    by 1000G,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    A=0.2650/1327
    HGVS:
    CM000670.2:g.18400593G>A, NC_000008.10:g.18258103G>A, NC_000008.11:g.18400593G>A, NG_012246.1:g.14349G>A, NM_000015.2:c.590G>A, NP_000006.2:p.Arg197Gln, XP_016868427.1:p.Arg197Gln
    2.

    rs4646269 has merged into rs1799930 [Homo sapiens]
      ATATACTTATTTACGCTTGAACCTC[A/G]AACAATTGAAGATTTTGAGTCTATG
      Chromosome:
      8:18400593
      Gene:
      NAT2 (GeneView)
      Functional Consequence:
      missense
      Allele Origin:
      G(germline)/A(germline)
      Clinical significance:
      drug-response
      Validated:
      by 1000G,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      A=0.2650/1327
      HGVS:
      CM000670.2:g.18400593G>A, NC_000008.10:g.18258103G>A, NC_000008.11:g.18400593G>A, NG_012246.1:g.14349G>A, NM_000015.2:c.590G>A, NP_000006.2:p.Arg197Gln, XP_016868427.1:p.Arg197Gln
      3.

      rs17517027 has merged into rs1799930 [Homo sapiens]
        ATATACTTATTTACGCTTGAACCTC[A/G]AACAATTGAAGATTTTGAGTCTATG
        Chromosome:
        8:18400593
        Gene:
        NAT2 (GeneView)
        Functional Consequence:
        missense
        Allele Origin:
        G(germline)/A(germline)
        Clinical significance:
        drug-response
        Validated:
        by 1000G,by cluster,by frequency,by hapmap,by submitter
        Global MAF:
        A=0.2650/1327
        HGVS:
        CM000670.2:g.18400593G>A, NC_000008.10:g.18258103G>A, NC_000008.11:g.18400593G>A, NG_012246.1:g.14349G>A, NM_000015.2:c.590G>A, NP_000006.2:p.Arg197Gln, XP_016868427.1:p.Arg197Gln
        4.

        rs17856496 has merged into rs1799930 [Homo sapiens]
          ATATACTTATTTACGCTTGAACCTC[A/G]AACAATTGAAGATTTTGAGTCTATG
          Chromosome:
          8:18400593
          Gene:
          NAT2 (GeneView)
          Functional Consequence:
          missense
          Allele Origin:
          G(germline)/A(germline)
          Clinical significance:
          drug-response
          Validated:
          by 1000G,by cluster,by frequency,by hapmap,by submitter
          Global MAF:
          A=0.2650/1327
          HGVS:
          CM000670.2:g.18400593G>A, NC_000008.10:g.18258103G>A, NC_000008.11:g.18400593G>A, NG_012246.1:g.14349G>A, NM_000015.2:c.590G>A, NP_000006.2:p.Arg197Gln, XP_016868427.1:p.Arg197Gln
          5.

          rs60190029 has merged into rs1799930 [Homo sapiens]
            ATATACTTATTTACGCTTGAACCTC[A/G]AACAATTGAAGATTTTGAGTCTATG
            Chromosome:
            8:18400593
            Gene:
            NAT2 (GeneView)
            Functional Consequence:
            missense
            Allele Origin:
            G(germline)/A(germline)
            Clinical significance:
            drug-response
            Validated:
            by 1000G,by cluster,by frequency,by hapmap,by submitter
            Global MAF:
            A=0.2650/1327
            HGVS:
            CM000670.2:g.18400593G>A, NC_000008.10:g.18258103G>A, NC_000008.11:g.18400593G>A, NG_012246.1:g.14349G>A, NM_000015.2:c.590G>A, NP_000006.2:p.Arg197Gln, XP_016868427.1:p.Arg197Gln
            6.

            rs61467963 has merged into rs1799930 [Homo sapiens]
              ATATACTTATTTACGCTTGAACCTC[A/G]AACAATTGAAGATTTTGAGTCTATG
              Chromosome:
              8:18400593
              Gene:
              NAT2 (GeneView)
              Functional Consequence:
              missense
              Allele Origin:
              G(germline)/A(germline)
              Clinical significance:
              drug-response
              Validated:
              by 1000G,by cluster,by frequency,by hapmap,by submitter
              Global MAF:
              A=0.2650/1327
              HGVS:
              CM000670.2:g.18400593G>A, NC_000008.10:g.18258103G>A, NC_000008.11:g.18400593G>A, NG_012246.1:g.14349G>A, NM_000015.2:c.590G>A, NP_000006.2:p.Arg197Gln, XP_016868427.1:p.Arg197Gln

              Display Settings:

              Format
              Items per page
              Sort by

              Send to:

              Choose Destination

              Supplemental Content

              Find related data

              Search details

              See more...

              Recent activity

              Your browsing activity is empty.

              Activity recording is turned off.

              Turn recording back on

              See more...
              Support Center