Display Settings:

Format
Sort by

Send to:

Choose Destination

Search results

Items: 5

1.

rs1799929 [Homo sapiens]
    GACAGAAGAGAGAGGAATCTGGTAC[C/T]TGGACCAAATCAGGAGAGAGCAGTA
    Chromosome:
    8:18400484
    Gene:
    NAT2 (GeneView)
    Functional Consequence:
    synonymous codon
    Validated:
    by 1000G,by cluster,by frequency,by submitter
    Global MAF:
    T=0.2680/1342
    HGVS:
    CM000670.2:g.18400484C>T, NC_000008.10:g.18257994C>T, NC_000008.11:g.18400484C>T, NG_012246.1:g.14240C>T, NM_000015.2:c.481C>T, NP_000006.2:p.Leu161, XP_016868427.1:p.Leu161
    2.

    rs4646268 has merged into rs1799929 [Homo sapiens]
      GACAGAAGAGAGAGGAATCTGGTAC[C/T]TGGACCAAATCAGGAGAGAGCAGTA
      Chromosome:
      8:18400484
      Gene:
      NAT2 (GeneView)
      Functional Consequence:
      synonymous codon
      Validated:
      by 1000G,by cluster,by frequency,by submitter
      Global MAF:
      T=0.2680/1342
      HGVS:
      CM000670.2:g.18400484C>T, NC_000008.10:g.18257994C>T, NC_000008.11:g.18400484C>T, NG_012246.1:g.14240C>T, NM_000015.2:c.481C>T, NP_000006.2:p.Leu161, XP_016868427.1:p.Leu161
      3.

      rs17595342 has merged into rs1799929 [Homo sapiens]
        GACAGAAGAGAGAGGAATCTGGTAC[C/T]TGGACCAAATCAGGAGAGAGCAGTA
        Chromosome:
        8:18400484
        Gene:
        NAT2 (GeneView)
        Functional Consequence:
        synonymous codon
        Validated:
        by 1000G,by cluster,by frequency,by submitter
        Global MAF:
        T=0.2680/1342
        HGVS:
        CM000670.2:g.18400484C>T, NC_000008.10:g.18257994C>T, NC_000008.11:g.18400484C>T, NG_012246.1:g.14240C>T, NM_000015.2:c.481C>T, NP_000006.2:p.Leu161, XP_016868427.1:p.Leu161
        4.

        rs58882350 has merged into rs1799929 [Homo sapiens]
          GACAGAAGAGAGAGGAATCTGGTAC[C/T]TGGACCAAATCAGGAGAGAGCAGTA
          Chromosome:
          8:18400484
          Gene:
          NAT2 (GeneView)
          Functional Consequence:
          synonymous codon
          Validated:
          by 1000G,by cluster,by frequency,by submitter
          Global MAF:
          T=0.2680/1342
          HGVS:
          CM000670.2:g.18400484C>T, NC_000008.10:g.18257994C>T, NC_000008.11:g.18400484C>T, NG_012246.1:g.14240C>T, NM_000015.2:c.481C>T, NP_000006.2:p.Leu161, XP_016868427.1:p.Leu161
          5.

          rs60310310 has merged into rs1799929 [Homo sapiens]
            GACAGAAGAGAGAGGAATCTGGTAC[C/T]TGGACCAAATCAGGAGAGAGCAGTA
            Chromosome:
            8:18400484
            Gene:
            NAT2 (GeneView)
            Functional Consequence:
            synonymous codon
            Validated:
            by 1000G,by cluster,by frequency,by submitter
            Global MAF:
            T=0.2680/1342
            HGVS:
            CM000670.2:g.18400484C>T, NC_000008.10:g.18257994C>T, NC_000008.11:g.18400484C>T, NG_012246.1:g.14240C>T, NM_000015.2:c.481C>T, NP_000006.2:p.Leu161, XP_016868427.1:p.Leu161

            Display Settings:

            Format
            Sort by

            Send to:

            Choose Destination

            Supplemental Content

            Find related data

            Search details

            See more...

            Recent activity

            Your browsing activity is empty.

            Activity recording is turned off.

            Turn recording back on

            See more...
            Support Center