Display Settings:

Format
Sort by

Send to:

Choose Destination

Search results

Items: 4

1.

rs1041983 [Homo sapiens]
    CCACAATGTTAGGAGGGTATTTTTA[C/T]ATCCCTCCAGTTAACAAATACAGCA
    Chromosome:
    8:18400285
    Gene:
    NAT2 (GeneView)
    Functional Consequence:
    synonymous codon
    Clinical significance:
    drug-response
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    T=0.3974/1990
    HGVS:
    CM000670.2:g.18400285C>T, NC_000008.10:g.18257795C>T, NC_000008.11:g.18400285C>T, NG_012246.1:g.14041C>T, NM_000015.2:c.282C>T, NP_000006.2:p.Tyr94, XP_016868427.1:p.Tyr94
    2.

    rs17845484 has merged into rs1041983 [Homo sapiens]
      CCACAATGTTAGGAGGGTATTTTTA[C/T]ATCCCTCCAGTTAACAAATACAGCA
      Chromosome:
      8:18400285
      Gene:
      NAT2 (GeneView)
      Functional Consequence:
      synonymous codon
      Clinical significance:
      drug-response
      Validated:
      by 1000G,by cluster,by frequency
      Global MAF:
      T=0.3974/1990
      HGVS:
      CM000670.2:g.18400285C>T, NC_000008.10:g.18257795C>T, NC_000008.11:g.18400285C>T, NG_012246.1:g.14041C>T, NM_000015.2:c.282C>T, NP_000006.2:p.Tyr94, XP_016868427.1:p.Tyr94
      3.

      rs17858364 has merged into rs1041983 [Homo sapiens]
        CCACAATGTTAGGAGGGTATTTTTA[C/T]ATCCCTCCAGTTAACAAATACAGCA
        Chromosome:
        8:18400285
        Gene:
        NAT2 (GeneView)
        Functional Consequence:
        synonymous codon
        Clinical significance:
        drug-response
        Validated:
        by 1000G,by cluster,by frequency
        Global MAF:
        T=0.3974/1990
        HGVS:
        CM000670.2:g.18400285C>T, NC_000008.10:g.18257795C>T, NC_000008.11:g.18400285C>T, NG_012246.1:g.14041C>T, NM_000015.2:c.282C>T, NP_000006.2:p.Tyr94, XP_016868427.1:p.Tyr94
        4.

        rs59855457 has merged into rs1041983 [Homo sapiens]
          CCACAATGTTAGGAGGGTATTTTTA[C/T]ATCCCTCCAGTTAACAAATACAGCA
          Chromosome:
          8:18400285
          Gene:
          NAT2 (GeneView)
          Functional Consequence:
          synonymous codon
          Clinical significance:
          drug-response
          Validated:
          by 1000G,by cluster,by frequency
          Global MAF:
          T=0.3974/1990
          HGVS:
          CM000670.2:g.18400285C>T, NC_000008.10:g.18257795C>T, NC_000008.11:g.18400285C>T, NG_012246.1:g.14041C>T, NM_000015.2:c.282C>T, NP_000006.2:p.Tyr94, XP_016868427.1:p.Tyr94

          Display Settings:

          Format
          Sort by

          Send to:

          Choose Destination

          Supplemental Content

          Find related data

          Search details

          See more...

          Recent activity

          Your browsing activity is empty.

          Activity recording is turned off.

          Turn recording back on

          See more...
          Support Center