Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 9

1.

rs120074183 [Homo sapiens]
    AGCCTCCTGTCCATTCCTTCCCAGG[A/G]GATTCTTGGCTCGGGGTTTGCCCTG
    Chromosome:
    11:2585213
    Gene:
    KCNQ1 (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/A(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster
    HGVS:
    NC_000011.10:g.2585213G>A, NC_000011.9:g.2606443G>A, NG_008935.1:g.145223G>A, NM_000218.2:c.1034G>A, NM_181798.1:c.653G>A, NP_000209.2:p.Gly345Glu, NP_861463.1:p.Gly218Glu, NR_040711.2:n.927G>A
    2.

    rs120074182 [Homo sapiens]
      CTCTCCCTGCAGGTCACAGTCACCA[C/T]CATCGGCTATGGGGACAAGGTGCCC
      Chromosome:
      11:2583448
      Gene:
      KCNQ1 (GeneView)
      Functional Consequence:
      missense
      Allele Origin:
      T(germline)/C(germline)
      Clinical significance:
      Pathogenic
      Validated:
      by cluster
      HGVS:
      NC_000011.10:g.2583448C>T, NC_000011.9:g.2604678C>T, NG_008935.1:g.143458C>T, NM_000218.2:c.935C>T, NM_181798.1:c.554C>T, NP_000209.2:p.Thr312Ile, NP_861463.1:p.Thr185Ile, NR_040711.2:n.828C>T
      3.
      4.

      rs120074180 [Homo sapiens]
        CACCCTGTACATCGGCTTCCTGGGC[C/T]TCATCTTCTCCTCGTACTTTGTGTA
        Chromosome:
        11:2572882
        Gene:
        KCNQ1 (GeneView)
        Functional Consequence:
        missense
        Allele Origin:
        T(germline)/C(germline)
        Clinical significance:
        Pathogenic
        Validated:
        by cluster
        HGVS:
        NC_000011.10:g.2572882C>T, NC_000011.9:g.2594112C>T, NG_008935.1:g.132892C>T, NM_000218.2:c.817C>T, NM_181798.1:c.436C>T, NP_000209.2:p.Leu273Phe, NP_861463.1:p.Leu146Phe, NR_040711.2:n.710C>T
        7.
        8.

        Display Settings:

        Format
        Items per page
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center