Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs28930069 [Homo sapiens]
    CTCCAGCGCCTTCTTCCGCCTGTTC[C/G]GTGTCATGAGGCTGATCAAGCTGCT
    Chromosome:
    1:201053539
    Gene:
    CACNA1S (GeneView)
    Functional Consequence:
    missense
    Allele Origin:
    G(germline)/C(germline)
    Clinical significance:
    Pathogenic
    Validated:
    by cluster
    HGVS:
    NC_000001.10:g.201022667G>C, NC_000001.11:g.201053539G>C, NG_009816.1:g.64028C>G, NM_000069.2:c.3715C>G, NP_000060.2:p.Arg1239Gly, XM_005245478.1:c.3658C>G, XM_005245478.3:c.3658C>G, XP_005245535.1:p.Arg1220Gly
    2.

    rs28930068 [Homo sapiens]
      TCCAGCGCCTTCTTCCGCCTGTTCC[A/G]TGTCATGAGGCTGATCAAGCTGCTG
      Chromosome:
      1:201053538
      Gene:
      CACNA1S (GeneView)
      Functional Consequence:
      missense
      Allele Origin:
      G(germline)/A(germline)
      Clinical significance:
      Pathogenic
      Validated:
      by cluster
      HGVS:
      NC_000001.10:g.201022666C>T, NC_000001.11:g.201053538C>T, NG_009816.1:g.64029G>A, NM_000069.2:c.3716G>A, NP_000060.2:p.Arg1239His, XM_005245478.1:c.3659G>A, XM_005245478.3:c.3659G>A, XP_005245535.1:p.Arg1220His

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center