Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs10004195 [Homo sapiens]
    ATTCATTATAATCTTAGCACTTTTT[A/T]AAATTGTGGTCAAATACACATAACA
    Chromosome:
    4:38783103
    Gene:
    TLR10 (GeneView)
    Functional Consequence:
    upstream variant 2KB
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.3736/1871
    HGVS:
    NC_000004.11:g.38784724T>A, NC_000004.12:g.38783103T>A, NM_001017388.2:c.-245A>T, NM_001195106.1:c.-562A>T, NM_001195107.1:c.-434A>T, NM_001195108.1:c.-507A>T, NM_030956.3:c.-751A>T, XM_011513760.2:c.-190A>T, XM_011513761.2:c.-832A>T, XM_011513762.2:c.-532A>T

    Supplemental Content

    Find related data

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center