Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs11252394 [Homo sapiens]
    CTTAATGTTTCTAGTATTAACATGT[A/G]TACTGACAACTTGATAATCCTTTGA
    Chromosome:
    10:4198678
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.0234/117
    HGVS:
    NC_000010.10:g.4240870G>A, NC_000010.11:g.4198678G>A
    2.

    rs6988229 [Homo sapiens]
      ATGAGAATAGAGCTAACTATGAACA[C/T]ATCCACAACAGGGTGGGAGAGGGGG
      Chromosome:
      8:138872266
      Gene:
      COL22A1 (GeneView)
      Functional Consequence:
      intron variant
      Clinical significance:
      drug-response
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.2382/1193
      HGVS:
      NC_000008.10:g.139884509C>T, NC_000008.11:g.138872266C>T, NM_152888.2:c.658+5484G>A, XM_005250810.1:c.658+5484G>A, XM_011516883.2:c.658+5484G>A, XM_011516884.2:c.658+5484G>A, XM_011516885.2:c.658+5484G>A, XM_011516886.2:c.571+5484G>A, XM_011516888.2:c.658+5484G>A, XM_017013150.1:c.532+5484G>A, XM_017013151.1:c.658+5484G>A, XR_001745487.1:n.1199+5484G>A

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center