Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs55705857 [Homo sapiens]
    GGACTTGCTCAGAAGCCGTTCTGCA[A/G]ATGCATTTCTTGAACAAAGGGCCAA
    Chromosome:
    8:129633446
    Gene:
    CCDC26 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    G=0.0182/91
    HGVS:
    NC_000008.10:g.130645692A>G, NC_000008.11:g.129633446A>G, NR_130917.1:n.312+46482T>C
    2.

    rs498872 [Homo sapiens]
      CTTACCTTGCAAAGCCAGCTCTTGG[C/T]CCAGGAGACTGGCTGGGGAGGCCCT
      Chromosome:
      11:118606652
      Gene:
      PHLDB1 (GeneView)
      Functional Consequence:
      upstream variant 2KB,utr variant 5 prime
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.2456/1230
      HGVS:
      NC_000011.10:g.118606652A>G, NC_000011.9:g.118477367A>G, NM_001144758.2:c.-1069A>G, NM_001144759.2:c.-1069A>G, NM_015157.3:c.-199A>G, NW_003871072.2:g.232090A>G, XM_005271466.1:c.-1069A>G, XM_006718796.3:c.-1069A>G, XM_011542708.2:c.-1069A>G, XM_011542709.2:c.-42A>G

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center