Display Settings:

Format

Send to:

Choose Destination

Links from PubMed

1.

rs25531 [Homo sapiens]
    CTCGCGGCATCCCCCCTGCACCCCC[A/G]GCATCCCCCCTGCAGCCCCCCCAGC
    Chromosome:
    17:30237328
    Gene:
    LOC105371720 (GeneView) SLC6A4 (GeneView)
    Functional Consequence:
    intron variant,upstream variant 2KB
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    C=0.1376/689
    HGVS:
    NC_000017.10:g.28564346T>C, NC_000017.11:g.30237328T>C, NG_011747.2:g.3609A>G, NM_001045.5:c.-1936A>G, XM_005258025.1:c.-1810A>G, XR_001752824.1:n.280+258T>C

    Supplemental Content

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center