Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs10133840 [Homo sapiens]
    CTTCTCTCGCGTTCAGAAACCTCCA[C/G]AATGAAGATGAGACCTTGGTCCACT
    Chromosome:
    14:94944192
    Gene:
    LOC107984639 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    C=0.1392/697
    HGVS:
    NC_000014.8:g.95410529C>G, NC_000014.9:g.94944192C>G, XR_001750935.1:n.500-263G>C
    2.

    Supplemental Content

    Find related data

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center