Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 5

1.

rs3130453 [Homo sapiens]
    TATTTGAAGGCTCTAGATTCTGTCT[C/T]CAGCCATCTATGTTCCCCTGGACAA
    Chromosome:
    6:31157072
    Gene:
    CCHCR1 (GeneView) TCF19 (GeneView)
    Functional Consequence:
    stop gained,upstream variant 2KB,utr variant 5 prime
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.4692/2350
    HGVS:
    NC_000006.11:g.31124849C>T, NC_000006.12:g.31157072C>T, NM_001077511.1:c.-1978C>T, NM_001105563.1:c.234G>A, NM_001105564.1:c.234G>A, NM_001318908.1:c.-2117C>T, NM_007109.2:c.-2224C>T, NM_019052.3:c.-34G>A, NP_001099033.1:p.Trp78Ter, NP_001099034.1:p.Trp78Ter, NT_113891.3:g.2639496T, NT_113891.3:g.2639496T>C, NT_167245.2:g.2416388T, NT_167245.2:g.2416388T>C, NT_167246.2:g.2467603T, NT_167246.2:g.2467603T>C, NT_167247.2:g.2501217T, NT_167247.2:g.2501217T>C, NT_167248.2:g.2415100C>T, XM_005249334.1:c.-2117C>T, XM_005249335.1:c.-2398C>T, XM_005249336.1:c.-2398C>T, XM_005272832.1:c.-34A, XM_005272832.1:c.-34A>G, XM_005272833.1:c.-34A, XM_005272833.1:c.-34A>G, XM_005272834.1:c.-34A, XM_005272834.1:c.-34A>G, XM_005272835.1:c.-34A, XM_005272835.1:c.-34A>G, XM_005272836.1:c.-34A, XM_005272836.1:c.-34A>G, XM_005272837.1:c.-34A, XM_005272837.1:c.-34A>G, XM_005272838.1:c.-34A, XM_005272838.1:c.-34A>G, XM_005272839.1:c.-558A, XM_005272839.1:c.-558A>G, XM_005272840.1:c.-558A, XM_005272840.1:c.-558A>G, XM_005272865.1:c.-2402C>T, XM_005272866.1:c.-2295C>T, XM_005272867.1:c.-2121C>T, XM_005272868.1:c.-2402C>T, XM_005274987.1:c.-34A, XM_005274987.1:c.-34A>G, XM_005274988.1:c.-34A, XM_005274988.1:c.-34A>G, XM_005274989.1:c.-34A, XM_005274989.1:c.-34A>G, XM_005274990.1:c.-34A, XM_005274990.1:c.-34A>G, XM_005274991.1:c.-34A, XM_005274991.1:c.-34A>G, XM_005274992.1:c.-34A, XM_005274992.1:c.-34A>G, XM_005274993.1:c.-34A, XM_005274993.1:c.-34A>G, XM_005274994.1:c.-558A, XM_005274994.1:c.-558A>G, XM_005274995.1:c.-558A, XM_005274995.1:c.-558A>G, XM_005275018.1:c.-2402C>T, XM_005275019.1:c.-2295C>T, XM_005275020.1:c.-2121C>T, XM_005275137.1:c.-34A, XM_005275137.1:c.-34A>G, XM_005275138.1:c.-34A, XM_005275138.1:c.-34A>G, XM_005275139.1:c.-34A, XM_005275139.1:c.-34A>G, XM_005275140.1:c.-558A, XM_005275140.1:c.-558A>G, XM_005275155.1:c.-2402C>T, XM_005275156.1:c.-2295C>T, XM_005275157.1:c.-2121C>T, XM_005275265.1:c.-34A, XM_005275265.1:c.-34A>G, XM_005275266.1:c.-34A, XM_005275266.1:c.-34A>G, XM_005275267.1:c.-34A, XM_005275267.1:c.-34A>G, XM_005275268.1:c.-34A, XM_005275268.1:c.-34A>G, XM_005275269.1:c.-558A, XM_005275269.1:c.-558A>G, XM_005275287.1:c.-2402C>T, XM_005275288.1:c.-2295C>T, XM_005275289.1:c.-2121C>T, XM_005275422.1:c.234G>A, XM_005275423.1:c.-34G>A, XM_005275424.1:c.-34G>A, XM_005275449.1:c.-2402C>T, XM_005275450.1:c.-2121C>T, XM_005275451.1:c.-2402C>T, XM_011514702.2:c.261G>A, XM_011514703.1:c.-34G>A, XM_011514704.2:c.-34G>A, XM_011514705.1:c.-34G>A, XM_017010961.1:c.261G>A, XM_017010962.1:c.-34G>A, XM_017010963.1:c.-34G>A, XM_017010964.1:c.-34G>A, XM_017010965.1:c.-34G>A, XM_017010966.1:c.-34G>A, XM_017010967.1:c.-34G>A, XM_017010968.1:c.-34G>A, XM_017010969.1:c.-34G>A, XM_017010970.1:c.-558G>A, XP_005275479.1:p.Trp78Ter, XP_011513004.1:p.Trp87Ter, XP_016866450.1:p.Trp87Ter, XR_247374.1:n.261A, XR_247374.1:n.261A>G, XR_247390.1:n.261A, XR_247390.1:n.261A>G
    2.

    rs130079 [Homo sapiens]
      GCTGCAGCTGGAGGTAGCACGCCAG[G/T]GCCAGCAGGAGAGCACAGAGGAGGC
      Chromosome:
      6:31144960
      Gene:
      CCHCR1 (GeneView)
      Functional Consequence:
      missense
      Validated:
      by 1000G,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.1418/710
      HGVS:
      NC_000006.11:g.31112737C>A, NC_000006.12:g.31144960C>A, NM_001105563.1:c.1882G>T, NM_001105564.1:c.1990G>T, NM_019052.3:c.1723G>T, NP_001099033.1:p.Gly628Cys, NP_001099034.1:p.Gly664Cys, NP_061925.2:p.Gly575Cys, NT_113891.3:g.2627391A, NT_113891.3:g.2627391A>C, NT_167245.2:g.2404282A, NT_167245.2:g.2404282A>C, NT_167246.2:g.2455475C>A, NT_167247.2:g.2489088C>A, NT_167248.2:g.2402978C>A, XM_005272832.1:c.1723T, XM_005272832.1:c.1723T>G, XM_005272833.1:c.1723T, XM_005272833.1:c.1723T>G, XM_005272834.1:c.1723T, XM_005272834.1:c.1723T>G, XM_005272835.1:c.1723T, XM_005272835.1:c.1723T>G, XM_005272836.1:c.1723T, XM_005272836.1:c.1723T>G, XM_005272837.1:c.1723T, XM_005272837.1:c.1723T>G, XM_005272838.1:c.1615T, XM_005272838.1:c.1615T>G, XM_005272839.1:c.895T, XM_005272839.1:c.895T>G, XM_005272840.1:c.895T, XM_005272840.1:c.895T>G, XM_005274987.1:c.1723T, XM_005274987.1:c.1723T>G, XM_005274988.1:c.1723T, XM_005274988.1:c.1723T>G, XM_005274989.1:c.1723T, XM_005274989.1:c.1723T>G, XM_005274990.1:c.1723T, XM_005274990.1:c.1723T>G, XM_005274991.1:c.1723T, XM_005274991.1:c.1723T>G, XM_005274992.1:c.1723T, XM_005274992.1:c.1723T>G, XM_005274993.1:c.1615T, XM_005274993.1:c.1615T>G, XM_005274994.1:c.895T, XM_005274994.1:c.895T>G, XM_005274995.1:c.895T, XM_005274995.1:c.895T>G, XM_005275137.1:c.1723G>T, XM_005275138.1:c.1723G>T, XM_005275139.1:c.1723G>T, XM_005275140.1:c.895G>T, XM_005275265.1:c.1723G>T, XM_005275266.1:c.1723G>T, XM_005275267.1:c.1723G>T, XM_005275268.1:c.1615G>T, XM_005275269.1:c.895G>T, XM_005275422.1:c.1990G>T, XM_005275423.1:c.1723G>T, XM_005275424.1:c.1723G>T, XM_011514702.2:c.1909G>T, XM_011514703.1:c.1723G>T, XM_011514704.2:c.1615G>T, XM_011514705.1:c.1615G>T, XM_017010961.1:c.2017G>T, XM_017010962.1:c.1723G>T, XM_017010963.1:c.1723G>T, XM_017010964.1:c.1723G>T, XM_017010965.1:c.1723G>T, XM_017010966.1:c.1723G>T, XM_017010967.1:c.1723G>T, XM_017010968.1:c.1723G>T, XM_017010969.1:c.1615G>T, XM_017010970.1:c.895G>T, XP_005272889.1:p.Cys575, XP_005272889.1:p.Cys575Gly, XP_005272890.1:p.Cys575, XP_005272890.1:p.Cys575Gly, XP_005272891.1:p.Cys575, XP_005272891.1:p.Cys575Gly, XP_005272892.1:p.Cys575, XP_005272892.1:p.Cys575Gly, XP_005272893.1:p.Cys575, XP_005272893.1:p.Cys575Gly, XP_005272894.1:p.Cys575, XP_005272894.1:p.Cys575Gly, XP_005272895.1:p.Cys539, XP_005272895.1:p.Cys539Gly, XP_005272896.1:p.Cys299, XP_005272896.1:p.Cys299Gly, XP_005272897.1:p.Cys299, XP_005272897.1:p.Cys299Gly, XP_005275044.1:p.Cys575, XP_005275044.1:p.Cys575Gly, XP_005275045.1:p.Cys575, XP_005275045.1:p.Cys575Gly, XP_005275046.1:p.Cys575, XP_005275046.1:p.Cys575Gly, XP_005275047.1:p.Cys575, XP_005275047.1:p.Cys575Gly, XP_005275048.1:p.Cys575, XP_005275048.1:p.Cys575Gly, XP_005275049.1:p.Cys575, XP_005275049.1:p.Cys575Gly, XP_005275050.1:p.Cys539, XP_005275050.1:p.Cys539Gly, XP_005275051.1:p.Cys299, XP_005275051.1:p.Cys299Gly, XP_005275052.1:p.Cys299, XP_005275052.1:p.Cys299Gly, XP_005275194.1:p.Gly575Cys, XP_005275195.1:p.Gly575Cys, XP_005275196.1:p.Gly575Cys, XP_005275197.1:p.Gly299Cys, XP_005275322.1:p.Gly575Cys, XP_005275323.1:p.Gly575Cys, XP_005275324.1:p.Gly575Cys, XP_005275325.1:p.Gly539Cys, XP_005275326.1:p.Gly299Cys, XP_005275479.1:p.Gly664Cys, XP_005275480.1:p.Gly575Cys, XP_005275481.1:p.Gly575Cys, XP_011513004.1:p.Gly637Cys, XP_011513005.1:p.Gly575Cys, XP_011513006.1:p.Gly539Cys, XP_011513007.1:p.Gly539Cys, XP_016866450.1:p.Gly673Cys, XP_016866451.1:p.Gly575Cys, XP_016866452.1:p.Gly575Cys, XP_016866453.1:p.Gly575Cys, XP_016866454.1:p.Gly575Cys, XP_016866455.1:p.Gly575Cys, XP_016866456.1:p.Gly575Cys, XP_016866457.1:p.Gly575Cys, XP_016866458.1:p.Gly539Cys, XP_016866459.1:p.Gly299Cys, XR_247374.1:n.2017G>T, XR_247390.1:n.2017G>T
      3.

      rs130076 [Homo sapiens]
        GCTGCGGCGGCTGGAGGAGGAGGTC[C/T]GGCTCCTGCGGGAGACCTCGCTGCA
        Chromosome:
        6:31154705
        Gene:
        CCHCR1 (GeneView)
        Functional Consequence:
        intron variant,missense
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.1234/618
        HGVS:
        NC_000006.11:g.31122482G>A, NC_000006.12:g.31154705G>A, NM_001105563.1:c.484C>T, NM_001105564.1:c.592C>T, NM_019052.3:c.325C>T, NP_001099033.1:p.Arg162Trp, NP_001099034.1:p.Arg198Trp, NP_061925.2:p.Arg109Trp, NT_113891.3:g.2637117A, NT_113891.3:g.2637117A>G, NT_167245.2:g.2414008A, NT_167245.2:g.2414008A>G, NT_167246.2:g.2465222G>A, NT_167247.2:g.2498836G>A, NT_167248.2:g.2412720G>A, XM_005272832.1:c.325T, XM_005272832.1:c.325T>C, XM_005272833.1:c.325T, XM_005272833.1:c.325T>C, XM_005272834.1:c.325T, XM_005272834.1:c.325T>C, XM_005272835.1:c.325T, XM_005272835.1:c.325T>C, XM_005272836.1:c.325T, XM_005272836.1:c.325T>C, XM_005272837.1:c.325T, XM_005272837.1:c.325T>C, XM_005272838.1:c.217T, XM_005272838.1:c.217T>C, XM_005272839.1:c.-295+2038C>T, XM_005272840.1:c.-295+2038C>T, XM_005274987.1:c.325T, XM_005274987.1:c.325T>C, XM_005274988.1:c.325T, XM_005274988.1:c.325T>C, XM_005274989.1:c.325T, XM_005274989.1:c.325T>C, XM_005274990.1:c.325T, XM_005274990.1:c.325T>C, XM_005274991.1:c.325T, XM_005274991.1:c.325T>C, XM_005274992.1:c.325T, XM_005274992.1:c.325T>C, XM_005274993.1:c.217T, XM_005274993.1:c.217T>C, XM_005274994.1:c.-295+2039C>T, XM_005274995.1:c.-295+2039C>T, XM_005275137.1:c.325C>T, XM_005275138.1:c.325C>T, XM_005275139.1:c.325C>T, XM_005275140.1:c.-295+2040C>T, XM_005275265.1:c.325C>T, XM_005275266.1:c.325C>T, XM_005275267.1:c.325C>T, XM_005275268.1:c.217C>T, XM_005275269.1:c.-295+2040C>T, XM_005275422.1:c.592C>T, XM_005275423.1:c.325C>T, XM_005275424.1:c.325C>T, XM_011514702.2:c.511C>T, XM_011514703.1:c.325C>T, XM_011514704.2:c.217C>T, XM_011514705.1:c.217C>T, XM_017010961.1:c.619C>T, XM_017010962.1:c.325C>T, XM_017010963.1:c.325C>T, XM_017010964.1:c.325C>T, XM_017010965.1:c.325C>T, XM_017010966.1:c.325C>T, XM_017010967.1:c.325C>T, XM_017010968.1:c.325C>T, XM_017010969.1:c.217C>T, XM_017010970.1:c.-295+2026C>T, XP_005272889.1:p.Trp109, XP_005272889.1:p.Trp109Arg, XP_005272890.1:p.Trp109, XP_005272890.1:p.Trp109Arg, XP_005272891.1:p.Trp109, XP_005272891.1:p.Trp109Arg, XP_005272892.1:p.Trp109, XP_005272892.1:p.Trp109Arg, XP_005272893.1:p.Trp109, XP_005272893.1:p.Trp109Arg, XP_005272894.1:p.Trp109, XP_005272894.1:p.Trp109Arg, XP_005272895.1:p.Trp73, XP_005272895.1:p.Trp73Arg, XP_005275044.1:p.Trp109, XP_005275044.1:p.Trp109Arg, XP_005275045.1:p.Trp109, XP_005275045.1:p.Trp109Arg, XP_005275046.1:p.Trp109, XP_005275046.1:p.Trp109Arg, XP_005275047.1:p.Trp109, XP_005275047.1:p.Trp109Arg, XP_005275048.1:p.Trp109, XP_005275048.1:p.Trp109Arg, XP_005275049.1:p.Trp109, XP_005275049.1:p.Trp109Arg, XP_005275050.1:p.Trp73, XP_005275050.1:p.Trp73Arg, XP_005275194.1:p.Arg109Trp, XP_005275195.1:p.Arg109Trp, XP_005275196.1:p.Arg109Trp, XP_005275322.1:p.Arg109Trp, XP_005275323.1:p.Arg109Trp, XP_005275324.1:p.Arg109Trp, XP_005275325.1:p.Arg73Trp, XP_005275479.1:p.Arg198Trp, XP_005275480.1:p.Arg109Trp, XP_005275481.1:p.Arg109Trp, XP_011513004.1:p.Arg171Trp, XP_011513005.1:p.Arg109Trp, XP_011513006.1:p.Arg73Trp, XP_011513007.1:p.Arg73Trp, XP_016866450.1:p.Arg207Trp, XP_016866451.1:p.Arg109Trp, XP_016866452.1:p.Arg109Trp, XP_016866453.1:p.Arg109Trp, XP_016866454.1:p.Arg109Trp, XP_016866455.1:p.Arg109Trp, XP_016866456.1:p.Arg109Trp, XP_016866457.1:p.Arg109Trp, XP_016866458.1:p.Arg73Trp, XR_247374.1:n.619C>T, XR_247390.1:n.619C>T
        4.

        rs130065 [Homo sapiens]
          CGTTCGGCAGCTGCAAGAGCTGCGG[C/T]GGCTGGAGGAGGAGGTCCGGCTCCT
          Chromosome:
          6:31154723
          Gene:
          CCHCR1 (GeneView)
          Functional Consequence:
          intron variant,missense
          Validated:
          by 1000G,by cluster,by frequency,by hapmap
          Global MAF:
          A=0.1194/598
          HGVS:
          NC_000006.11:g.31122500G>A, NC_000006.12:g.31154723G>A, NM_001105563.1:c.466C>T, NM_001105564.1:c.574C>T, NM_019052.3:c.307C>T, NP_001099033.1:p.Arg156Trp, NP_001099034.1:p.Arg192Trp, NP_061925.2:p.Arg103Trp, NT_113891.3:g.2637135A, NT_113891.3:g.2637135A>G, NT_167245.2:g.2414026A, NT_167245.2:g.2414026A>G, NT_167246.2:g.2465240G>A, NT_167247.2:g.2498854G>A, NT_167248.2:g.2412738G>A, XM_005272832.1:c.307T, XM_005272832.1:c.307T>C, XM_005272833.1:c.307T, XM_005272833.1:c.307T>C, XM_005272834.1:c.307T, XM_005272834.1:c.307T>C, XM_005272835.1:c.307T, XM_005272835.1:c.307T>C, XM_005272836.1:c.307T, XM_005272836.1:c.307T>C, XM_005272837.1:c.307T, XM_005272837.1:c.307T>C, XM_005272838.1:c.199T, XM_005272838.1:c.199T>C, XM_005272839.1:c.-295+2020C>T, XM_005272840.1:c.-295+2020C>T, XM_005274987.1:c.307T, XM_005274987.1:c.307T>C, XM_005274988.1:c.307T, XM_005274988.1:c.307T>C, XM_005274989.1:c.307T, XM_005274989.1:c.307T>C, XM_005274990.1:c.307T, XM_005274990.1:c.307T>C, XM_005274991.1:c.307T, XM_005274991.1:c.307T>C, XM_005274992.1:c.307T, XM_005274992.1:c.307T>C, XM_005274993.1:c.199T, XM_005274993.1:c.199T>C, XM_005274994.1:c.-295+2021C>T, XM_005274995.1:c.-295+2021C>T, XM_005275137.1:c.307C>T, XM_005275138.1:c.307C>T, XM_005275139.1:c.307C>T, XM_005275140.1:c.-295+2022C>T, XM_005275265.1:c.307C>T, XM_005275266.1:c.307C>T, XM_005275267.1:c.307C>T, XM_005275268.1:c.199C>T, XM_005275269.1:c.-295+2022C>T, XM_005275422.1:c.574C>T, XM_005275423.1:c.307C>T, XM_005275424.1:c.307C>T, XM_011514702.2:c.493C>T, XM_011514703.1:c.307C>T, XM_011514704.2:c.199C>T, XM_011514705.1:c.199C>T, XM_017010961.1:c.601C>T, XM_017010962.1:c.307C>T, XM_017010963.1:c.307C>T, XM_017010964.1:c.307C>T, XM_017010965.1:c.307C>T, XM_017010966.1:c.307C>T, XM_017010967.1:c.307C>T, XM_017010968.1:c.307C>T, XM_017010969.1:c.199C>T, XM_017010970.1:c.-295+2008C>T, XP_005272889.1:p.Trp103, XP_005272889.1:p.Trp103Arg, XP_005272890.1:p.Trp103, XP_005272890.1:p.Trp103Arg, XP_005272891.1:p.Trp103, XP_005272891.1:p.Trp103Arg, XP_005272892.1:p.Trp103, XP_005272892.1:p.Trp103Arg, XP_005272893.1:p.Trp103, XP_005272893.1:p.Trp103Arg, XP_005272894.1:p.Trp103, XP_005272894.1:p.Trp103Arg, XP_005272895.1:p.Trp67, XP_005272895.1:p.Trp67Arg, XP_005275044.1:p.Trp103, XP_005275044.1:p.Trp103Arg, XP_005275045.1:p.Trp103, XP_005275045.1:p.Trp103Arg, XP_005275046.1:p.Trp103, XP_005275046.1:p.Trp103Arg, XP_005275047.1:p.Trp103, XP_005275047.1:p.Trp103Arg, XP_005275048.1:p.Trp103, XP_005275048.1:p.Trp103Arg, XP_005275049.1:p.Trp103, XP_005275049.1:p.Trp103Arg, XP_005275050.1:p.Trp67, XP_005275050.1:p.Trp67Arg, XP_005275194.1:p.Arg103Trp, XP_005275195.1:p.Arg103Trp, XP_005275196.1:p.Arg103Trp, XP_005275322.1:p.Arg103Trp, XP_005275323.1:p.Arg103Trp, XP_005275324.1:p.Arg103Trp, XP_005275325.1:p.Arg67Trp, XP_005275479.1:p.Arg192Trp, XP_005275480.1:p.Arg103Trp, XP_005275481.1:p.Arg103Trp, XP_011513004.1:p.Arg165Trp, XP_011513005.1:p.Arg103Trp, XP_011513006.1:p.Arg67Trp, XP_011513007.1:p.Arg67Trp, XP_016866450.1:p.Arg201Trp, XP_016866451.1:p.Arg103Trp, XP_016866452.1:p.Arg103Trp, XP_016866453.1:p.Arg103Trp, XP_016866454.1:p.Arg103Trp, XP_016866455.1:p.Arg103Trp, XP_016866456.1:p.Arg103Trp, XP_016866457.1:p.Arg103Trp, XP_016866458.1:p.Arg67Trp, XR_247374.1:n.601C>T, XR_247390.1:n.601C>T
          5.

          rs1576 [Homo sapiens]
            GACAACCTTGACAGATGCTCCAGCT[C/G/T]CAATCCCCAGATGAGCAGCTAAGCA
            Chromosome:
            6:31142614
            Gene:
            CCHCR1 (GeneView)
            Functional Consequence:
            missense
            Validated:
            by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
            Global MAF:
            C=0.2230/1117
            HGVS:
            NC_000006.11:g.31110391G>A, NC_000006.11:g.31110391G>C, NC_000006.12:g.31142614G>A, NC_000006.12:g.31142614G>C, NM_001105563.1:c.2486C>G, NM_001105563.1:c.2486C>T, NM_001105564.1:c.2594C>G, NM_001105564.1:c.2594C>T, NM_019052.3:c.2327C>G, NM_019052.3:c.2327C>T, NP_001099033.1:p.Ser829Cys, NP_001099033.1:p.Ser829Phe, NP_001099034.1:p.Ser865Cys, NP_001099034.1:p.Ser865Phe, NP_061925.2:p.Ser776Cys, NP_061925.2:p.Ser776Phe, NT_113891.3:g.2625045C, NT_113891.3:g.2625045C>A, NT_113891.3:g.2625045C>G, NT_167245.2:g.2401936C, NT_167245.2:g.2401936C>A, NT_167245.2:g.2401936C>G, NT_167246.2:g.2453129G>A, NT_167246.2:g.2453129G>C, NT_167247.2:g.2486742G>A, NT_167247.2:g.2486742G>C, NT_167248.2:g.2400629G>A, NT_167248.2:g.2400629G>C, XM_005272832.1:c.2327G, XM_005272832.1:c.2327G>C, XM_005272832.1:c.2327G>T, XM_005272833.1:c.2327G, XM_005272833.1:c.2327G>C, XM_005272833.1:c.2327G>T, XM_005272834.1:c.2327G, XM_005272834.1:c.2327G>C, XM_005272834.1:c.2327G>T, XM_005272835.1:c.2327G, XM_005272835.1:c.2327G>C, XM_005272835.1:c.2327G>T, XM_005272836.1:c.2327G, XM_005272836.1:c.2327G>C, XM_005272836.1:c.2327G>T, XM_005272837.1:c.2285G, XM_005272837.1:c.2285G>C, XM_005272837.1:c.2285G>T, XM_005272838.1:c.2219G, XM_005272838.1:c.2219G>C, XM_005272838.1:c.2219G>T, XM_005272839.1:c.1499G, XM_005272839.1:c.1499G>C, XM_005272839.1:c.1499G>T, XM_005272840.1:c.1499G, XM_005272840.1:c.1499G>C, XM_005272840.1:c.1499G>T, XM_005274987.1:c.2327G, XM_005274987.1:c.2327G>C, XM_005274987.1:c.2327G>T, XM_005274988.1:c.2327G, XM_005274988.1:c.2327G>C, XM_005274988.1:c.2327G>T, XM_005274989.1:c.2327G, XM_005274989.1:c.2327G>C, XM_005274989.1:c.2327G>T, XM_005274990.1:c.2327G, XM_005274990.1:c.2327G>C, XM_005274990.1:c.2327G>T, XM_005274991.1:c.2327G, XM_005274991.1:c.2327G>C, XM_005274991.1:c.2327G>T, XM_005274992.1:c.2285G, XM_005274992.1:c.2285G>C, XM_005274992.1:c.2285G>T, XM_005274993.1:c.2219G, XM_005274993.1:c.2219G>C, XM_005274993.1:c.2219G>T, XM_005274994.1:c.1499G, XM_005274994.1:c.1499G>C, XM_005274994.1:c.1499G>T, XM_005274995.1:c.1499G, XM_005274995.1:c.1499G>C, XM_005274995.1:c.1499G>T, XM_005275137.1:c.2327C>G, XM_005275137.1:c.2327C>T, XM_005275138.1:c.2285C>G, XM_005275138.1:c.2285C>T, XM_005275139.1:c.2225C>G, XM_005275139.1:c.2225C>T, XM_005275140.1:c.1499C>G, XM_005275140.1:c.1499C>T, XM_005275265.1:c.2327C>G, XM_005275265.1:c.2327C>T, XM_005275266.1:c.2285C>G, XM_005275266.1:c.2285C>T, XM_005275267.1:c.2225C>G, XM_005275267.1:c.2225C>T, XM_005275268.1:c.2219C>G, XM_005275268.1:c.2219C>T, XM_005275269.1:c.1499C>G, XM_005275269.1:c.1499C>T, XM_005275422.1:c.2492C>G, XM_005275422.1:c.2492C>T, XM_005275423.1:c.2327C>G, XM_005275423.1:c.2327C>T, XM_005275424.1:c.2327C>G, XM_005275424.1:c.2327C>T, XM_011514702.2:c.2513C>G, XM_011514702.2:c.2513C>T, XM_011514703.1:c.2327C>G, XM_011514703.1:c.2327C>T, XM_011514704.2:c.2219C>G, XM_011514704.2:c.2219C>T, XM_011514705.1:c.2219C>G, XM_011514705.1:c.2219C>T, XM_017010961.1:c.2621C>G, XM_017010961.1:c.2621C>T, XM_017010962.1:c.2327C>G, XM_017010962.1:c.2327C>T, XM_017010963.1:c.2327C>G, XM_017010963.1:c.2327C>T, XM_017010964.1:c.2327C>G, XM_017010964.1:c.2327C>T, XM_017010965.1:c.2327C>G, XM_017010965.1:c.2327C>T, XM_017010966.1:c.2327C>G, XM_017010966.1:c.2327C>T, XM_017010967.1:c.2327C>G, XM_017010967.1:c.2327C>T, XM_017010968.1:c.2327C>G, XM_017010968.1:c.2327C>T, XM_017010969.1:c.2219C>G, XM_017010969.1:c.2219C>T, XM_017010970.1:c.1499C>G, XM_017010970.1:c.1499C>T, XP_005272889.1:p.Cys776, XP_005272889.1:p.Cys776Phe, XP_005272889.1:p.Cys776Ser, XP_005272890.1:p.Cys776, XP_005272890.1:p.Cys776Phe, XP_005272890.1:p.Cys776Ser, XP_005272891.1:p.Cys776, XP_005272891.1:p.Cys776Phe, XP_005272891.1:p.Cys776Ser, XP_005272892.1:p.Cys776, XP_005272892.1:p.Cys776Phe, XP_005272892.1:p.Cys776Ser, XP_005272893.1:p.Cys776, XP_005272893.1:p.Cys776Phe, XP_005272893.1:p.Cys776Ser, XP_005272894.1:p.Cys762, XP_005272894.1:p.Cys762Phe, XP_005272894.1:p.Cys762Ser, XP_005272895.1:p.Cys740, XP_005272895.1:p.Cys740Phe, XP_005272895.1:p.Cys740Ser, XP_005272896.1:p.Cys500, XP_005272896.1:p.Cys500Phe, XP_005272896.1:p.Cys500Ser, XP_005272897.1:p.Cys500, XP_005272897.1:p.Cys500Phe, XP_005272897.1:p.Cys500Ser, XP_005275044.1:p.Cys776, XP_005275044.1:p.Cys776Phe, XP_005275044.1:p.Cys776Ser, XP_005275045.1:p.Cys776, XP_005275045.1:p.Cys776Phe, XP_005275045.1:p.Cys776Ser, XP_005275046.1:p.Cys776, XP_005275046.1:p.Cys776Phe, XP_005275046.1:p.Cys776Ser, XP_005275047.1:p.Cys776, XP_005275047.1:p.Cys776Phe, XP_005275047.1:p.Cys776Ser, XP_005275048.1:p.Cys776, XP_005275048.1:p.Cys776Phe, XP_005275048.1:p.Cys776Ser, XP_005275049.1:p.Cys762, XP_005275049.1:p.Cys762Phe, XP_005275049.1:p.Cys762Ser, XP_005275050.1:p.Cys740, XP_005275050.1:p.Cys740Phe, XP_005275050.1:p.Cys740Ser, XP_005275051.1:p.Cys500, XP_005275051.1:p.Cys500Phe, XP_005275051.1:p.Cys500Ser, XP_005275052.1:p.Cys500, XP_005275052.1:p.Cys500Phe, XP_005275052.1:p.Cys500Ser, XP_005275194.1:p.Ser776Cys, XP_005275194.1:p.Ser776Phe, XP_005275195.1:p.Ser762Cys, XP_005275195.1:p.Ser762Phe, XP_005275196.1:p.Ser742Cys, XP_005275196.1:p.Ser742Phe, XP_005275197.1:p.Ser500Cys, XP_005275197.1:p.Ser500Phe, XP_005275322.1:p.Ser776Cys, XP_005275322.1:p.Ser776Phe, XP_005275323.1:p.Ser762Cys, XP_005275323.1:p.Ser762Phe, XP_005275324.1:p.Ser742Cys, XP_005275324.1:p.Ser742Phe, XP_005275325.1:p.Ser740Cys, XP_005275325.1:p.Ser740Phe, XP_005275326.1:p.Ser500Cys, XP_005275326.1:p.Ser500Phe, XP_005275479.1:p.Ser831Cys, XP_005275479.1:p.Ser831Phe, XP_005275480.1:p.Ser776Cys, XP_005275480.1:p.Ser776Phe, XP_005275481.1:p.Ser776Cys, XP_005275481.1:p.Ser776Phe, XP_011513004.1:p.Ser838Cys, XP_011513004.1:p.Ser838Phe, XP_011513005.1:p.Ser776Cys, XP_011513005.1:p.Ser776Phe, XP_011513006.1:p.Ser740Cys, XP_011513006.1:p.Ser740Phe, XP_011513007.1:p.Ser740Cys, XP_011513007.1:p.Ser740Phe, XP_016866450.1:p.Ser874Cys, XP_016866450.1:p.Ser874Phe, XP_016866451.1:p.Ser776Cys, XP_016866451.1:p.Ser776Phe, XP_016866452.1:p.Ser776Cys, XP_016866452.1:p.Ser776Phe, XP_016866453.1:p.Ser776Cys, XP_016866453.1:p.Ser776Phe, XP_016866454.1:p.Ser776Cys, XP_016866454.1:p.Ser776Phe, XP_016866455.1:p.Ser776Cys, XP_016866455.1:p.Ser776Phe, XP_016866456.1:p.Ser776Cys, XP_016866456.1:p.Ser776Phe, XP_016866457.1:p.Ser776Cys, XP_016866457.1:p.Ser776Phe, XP_016866458.1:p.Ser740Cys, XP_016866458.1:p.Ser740Phe, XP_016866459.1:p.Ser500Cys, XP_016866459.1:p.Ser500Phe, XR_247374.1:n.2925C>G, XR_247374.1:n.2925C>T, XR_247390.1:n.2925C>G, XR_247390.1:n.2925C>T

            Display Settings:

            Format
            Sort by

            Send to:

            Choose Destination

            Supplemental Content

            Find related data

            Recent activity

            Your browsing activity is empty.

            Activity recording is turned off.

            Turn recording back on

            See more...
            Support Center