Display Settings:

Format
Items per page
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 18

1.

rs16861827 [Homo sapiens]
    CGTGGGCTTCCAGAGGCTTCTCTCA[C/T]AAAGCTGCAAGTATGGTACCTGGTG
    Chromosome:
    1:18351676
    Gene:
    IGSF21 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.1354/678
    HGVS:
    NC_000001.10:g.18678170C>T, NC_000001.11:g.18351676C>T, NG_027535.1:g.248931C>T, NM_032880.4:c.425-10439C>T, XM_011542319.2:c.424+16666C>T, XM_017002604.1:c.407-10439C>T, XM_017002605.1:c.194-10439C>T
    6.

    rs9874556 [Homo sapiens]
      AATTTCATCAAGTGAAACAGTCCCC[A/G]GAAGTCAGTCTACTATTCAAATCTC
      Chromosome:
      3:3314490
      Gene:
      LOC100130207 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      A=0.3520/1763
      HGVS:
      NC_000003.11:g.3356174A>G, NC_000003.12:g.3314490A>G, XR_001740402.1:n.1450+22810T>C
      7.

      rs9783347 [Homo sapiens]
        TAGGTTCGTTTACACCAGCATCCCT[A/G]CAAACGAGTGAATAATGTGCTGCTG
        Chromosome:
        11:18363391
        Gene:
        GTF2H1 (GeneView)
        Functional Consequence:
        intron variant
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
        Global MAF:
        A=0.3293/1649
        HGVS:
        NC_000011.10:g.18363391A>G, NC_000011.9:g.18384938A>G, NM_001142307.1:c.1561-2392A>G, NM_005316.3:c.1561-2392A>G, XM_006718208.3:c.1561-2392A>G
        8.

        rs9543325 [Homo sapiens]
          GATGCACGTGCTGCCCTTGCTGCAC[C/T]TCTATCACACCTGTGCCTTCTCTAT
          Chromosome:
          13:73342491
          Validated:
          by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
          Global MAF:
          T=0.4595/2301
          HGVS:
          NC_000013.10:g.73916628C>T, NC_000013.11:g.73342491C>T
          10.

          rs7853844 [Homo sapiens]
            aagacagctgtttgcaaactaggaa[A/G]agatccctcactggacaccagatct
            Chromosome:
            9:115288135
            Gene:
            DEC1 (GeneView)
            Functional Consequence:
            intron variant
            Validated:
            by 1000G,by cluster,by frequency,by hapmap
            Global MAF:
            A=0.1669/836
            HGVS:
            NC_000009.11:g.118050414G>A, NC_000009.12:g.115288135G>A, NG_027530.1:g.151318G>A, NM_017418.2:c.-307-3647G>A
            12.

            rs3790844 [Homo sapiens]
              CCAAGATCATCTAAGCGACAGACTT[C/T]CCAGTTTTAGTGACCTGTGTTTCCA
              Chromosome:
              1:200038304
              Gene:
              NR5A2 (GeneView)
              Functional Consequence:
              intron variant,upstream variant 2KB,utr variant 5 prime
              Validated:
              by 1000G,by cluster,by frequency,by hapmap
              Global MAF:
              G=0.3550/1778
              HGVS:
              NC_000001.10:g.200007432A>G, NC_000001.11:g.200038304A>G, NG_050913.1:g.15703A>G, NM_003822.4:c.65-5470A>G, NM_205860.2:c.65-1354A>G, XM_005245061.1:c.65-397A>G, XM_011509380.1:c.-56-1354A>G, XM_011509381.2:c.-525A>G, XM_011509382.1:c.-14-5470A>G, XM_011509384.2:c.-853A>G, XM_017000904.1:c.-884A>G
              13.

              rs1000589 [Homo sapiens]
                ATCACACATTAACAATGTATAGCTG[G/T]TAAACATATTAACTATCATGAATTT
                Chromosome:
                13:63567780
                Validated:
                by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                Global MAF:
                G=0.4349/2178
                HGVS:
                NC_000013.10:g.64141913G>T, NC_000013.11:g.63567780G>T
                15.

                rs763780 [Homo sapiens]
                  GTGGATATGCACCTCTTACTGCACA[C/T]GGTGGATGACAGGGGTGACGCAGGT
                  Chromosome:
                  6:52236941
                  Gene:
                  IL17F (GeneView)
                  Functional Consequence:
                  missense
                  Clinical significance:
                  Benign
                  Validated:
                  by 1000G,by cluster,by frequency,by hapmap,by submitter
                  Global MAF:
                  C=0.0935/468
                  HGVS:
                  NC_000006.11:g.52101739T>C, NC_000006.12:g.52236941T>C, NG_031869.1:g.12560A>G, NM_052872.3:c.482A>G, NP_443104.1:p.His161Arg, XM_011514276.1:c.482A>G, XP_011512578.1:p.His161Arg
                  16.

                  rs505922 [Homo sapiens]
                    TCAAGATGTATCCAGCTGTACCTTT[C/T]ATGTGCGGTTTATTGTATACATCCG
                    Validated:
                    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                    Global MAF:
                    C=0.3540/1773
                    HGVS:
                    NC_000009.11:g.136149229T>C, NG_006669.1:g.3822A>G, NM_020469.2:c.28+1350A>G, XM_005276848.1:c.28+1349A>G, XM_005276851.1:c.-261+1349A>G
                    17.

                    rs401681 [Homo sapiens]
                      CTGCTATCCAGACAACTTCAGAGTC[C/T]ATCATGGTGTGAAGCAGCTTTCTGG
                      Chromosome:
                      5:1321972
                      Gene:
                      CLPTM1L (GeneView)
                      Functional Consequence:
                      intron variant
                      Validated:
                      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
                      Global MAF:
                      T=0.4107/2057
                      HGVS:
                      NC_000005.10:g.1321972C>T, NC_000005.9:g.1322087C>T, NG_046903.1:g.28094G>A, NM_030782.4:c.1316-153G>A, NT_187547.1:g.192037G>A, XM_005248379.1:c.1313-153G>A, XM_005248380.1:c.1208-153G>A, XM_011514144.2:c.1313-153G>A
                      18.

                      rs167020 [Homo sapiens]
                        GGTATCATCTCAGGAGGCCGTCATC[A/G]AAACTTAGAAGTAAAATGCAAGCCA
                        Chromosome:
                        7:155827039
                        Validated:
                        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
                        Global MAF:
                        A=0.1498/750
                        HGVS:
                        NC_000007.13:g.155619733A>G, NC_000007.14:g.155827039A>G

                        Display Settings:

                        Format
                        Items per page
                        Sort by

                        Send to:

                        Choose Destination

                        Supplemental Content

                        Find related data

                        Recent activity

                        Your browsing activity is empty.

                        Activity recording is turned off.

                        Turn recording back on

                        See more...
                        Support Center