Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 4

3.

rs6140226 [Homo sapiens]
    GTGAATAGCCTTGCATTCCTCACCT[C/T]GGTAAAAAGATAGAACATTGCCCTT
    Chromosome:
    20:7245836
    Gene:
    LINC01428 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    T=0.4231/2119
    HGVS:
    NC_000020.10:g.7226483C>T, NC_000020.11:g.7245836C>T, NR_110609.1:n.117-3960G>A, XR_244238.1:n.3052-3960G>A
    4.

    rs1884302 [Homo sapiens]
      ATCATGCAGATAAGAGGATGGAATT[C/T]AGATACCAGGTAGATACAGAAATGT
      Chromosome:
      20:7125642
      Clinical significance:
      other
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      C=0.4217/2112
      HGVS:
      NC_000020.10:g.7106289T>C, NC_000020.11:g.7125642T>C

      Display Settings:

      Format
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center