Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

1.

rs2241766 [Homo sapiens]
    TTCTACTGCTATTAGCTCTGCCCGG[G/T]CATGACCAGGAAACCACGACTCAAG
    Chromosome:
    3:186853103
    Gene:
    ADIPOQ-AS1 (GeneView) ADIPOQ (GeneView)
    Functional Consequence:
    nc transcript variant,synonymous codon
    Validated:
    by 1000G,by cluster,by frequency
    Global MAF:
    G=0.1514/758
    HGVS:
    NC_000003.11:g.186570892T>G, NC_000003.12:g.186853103T>G, NG_021140.1:g.15430T>G, NM_001177800.1:c.45T>G, NM_004797.3:c.45T>G, NP_001171271.1:p.Gly15, NP_004788.1:p.Gly15, NR_046662.1:n.2226A>C
    3.

    rs266729 [Homo sapiens]
      TTGCAAGAACCGGCTCAGATCCTGC[A/C/G]CTTCAAAAACAAAACATGAGCGTGC
      Chromosome:
      3:186841685
      Gene:
      ADIPOQ (GeneView)
      Functional Consequence:
      upstream variant 2KB
      Validated:
      by 1000G,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      G=0.2264/1134
      HGVS:
      NC_000003.11:g.186559474C>G, NC_000003.12:g.186841685C>A, NC_000003.12:g.186841685C>G, NG_021140.1:g.4012C>A, NG_021140.1:g.4012C>G, NM_001177800.1:c.-1124C>A, NM_001177800.1:c.-1124C>G, NM_004797.3:c.-1073C>A, NM_004797.3:c.-1073C>G

      Display Settings:

      Format
      Sort by

      Send to:

      Choose Destination

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center