Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

3.

rs2736100 [Homo sapiens]
    ATTGTTTTCCGTGTTGAGTGTTTCT[G/T]TAGCTTTGCCCCCGCCCTGCTTTTC
    Chromosome:
    5:1286401
    Gene:
    TERT (GeneView)
    Functional Consequence:
    intron variant
    Clinical significance:
    other
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency
    Global MAF:
    C=0.4846/2427
    HGVS:
    CM000667.2:g.1286401C>A, NC_000005.10:g.1286401C>A, NC_000005.9:g.1286516C>A, NG_009265.1:g.13647G>T, NG_055468.1:g.28C>A, NM_001193376.1:c.1574-3777G>T, NM_198253.2:c.1574-3777G>T, NR_149162.1:n.1632-3777G>T, NR_149163.1:n.1632-3777G>T, XR_241712.1:n.1648-3777G>T, XR_241713.1:n.1648-3777G>T

    Display Settings:

    Format
    Sort by

    Send to:

    Choose Destination

    Supplemental Content

    Find related data

    Recent activity

    Your browsing activity is empty.

    Activity recording is turned off.

    Turn recording back on

    See more...
    Support Center