Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs2494938 [Homo sapiens]
    TGGTATATTGGAAATTGAGACAGCA[A/G]CTTCTCTGCATCAAGGAGACTCTTA
    Chromosome:
    6:40568389
    Gene:
    LRFN2 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.4762/2385
    HGVS:
    NC_000006.11:g.40536128G>A, NC_000006.12:g.40568389G>A, NM_020737.2:c.-19+18552C>T
    2.

    rs2285947 [Homo sapiens]
      AAATAAGTTTGTCAGTAGACAAGGC[A/G]ATAGAACACAACTCTAGTATTACCT
      Chromosome:
      7:21544470
      Gene:
      DNAH11 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      A=0.4097/2052
      HGVS:
      NC_000007.13:g.21584088G>A, NC_000007.14:g.21544470G>A, NG_012886.2:g.6256G>A, NM_001277115.1:c.352-536G>A

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center