Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 3

1.

rs4728142 [Homo sapiens]
    GTCACACCCCAAAAAGCTCTGAGCC[A/G]GTGTTAGTAAGAAATGGGGAGGAAG
    Chromosome:
    7:128933913
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.2945/1475
    HGVS:
    NC_000007.13:g.128573967G>A, NC_000007.14:g.128933913G>A, NG_012306.1:g.974G>A
    2.

    rs3024912 [Homo sapiens]
      CCCAAGGCCAGTTCCTTTACTCCTT[G/T]GTGAGCGCCTAAATGCTTTTAGGGT
      Chromosome:
      2:191028361
      Gene:
      LOC105373805 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
      Global MAF:
      C=0.3193/1599
      HGVS:
      NC_000002.11:g.191893087A>C, NC_000002.12:g.191028361A>C, NG_012852.1:g.127839T>G, NR_136318.1:n.31-2524A>C
      3.

      rs2736340 [Homo sapiens]
        CCCCATCGCATTGTATATGTACCCA[C/T]CAATCAGACCCATCACTAATGGTGG
        Chromosome:
        8:11486464
        Validated:
        by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
        Global MAF:
        T=0.3614/1810
        HGVS:
        NC_000008.10:g.11343973C>T, NC_000008.11:g.11486464C>T

        Display Settings:

        Format
        Sort by

        Send to:

        Choose Destination

        Supplemental Content

        Find related data

        Recent activity

        Your browsing activity is empty.

        Activity recording is turned off.

        Turn recording back on

        See more...
        Support Center