Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs1942836 [Homo sapiens]
    GCAGTAAATATATGGTATTTGTTAT[C/T]TGATTGATGGGGTCAAGGGAAGACT
    Chromosome:
    11:101178616
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap,by submitter
    Global MAF:
    C=0.4207/2107
    HGVS:
    CM000673.2:g.101178616T>C, NC_000011.9:g.101049347T>C
    2.

    rs883319 [Homo sapiens]
      ATCAACTCTTTGAGTCTCACAATAG[C/T]CCCATAAGAAAAGTGAACATCCCCC
      Chromosome:
      1:154785946
      Gene:
      KCNN3 (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      T=0.1901/952
      HGVS:
      CM000663.2:g.154785946C>T, NC_000001.10:g.154758422C>T, NC_000001.11:g.154785946C>T, NG_016807.2:g.89333G>A, NM_001204087.1:c.1030-13553G>A, NM_002249.5:c.1030-13553G>A, NM_170782.2:c.115-13553G>A

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center