Display Settings:

Format
Sort by

Send to:

Choose Destination

Links from PubMed

Items: 2

1.

rs3790567 [Homo sapiens]
    TGAAAAGCCCTCCTCTCTACCCTAA[A/G]CATACATGGAGGACCATGAGCTATA
    Chromosome:
    1:67356694
    Gene:
    IL12RB2 (GeneView)
    Functional Consequence:
    intron variant
    Validated:
    by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
    Global MAF:
    A=0.3956/1981
    HGVS:
    CM000663.2:g.67356694A>G, NC_000001.10:g.67822377A>G, NC_000001.11:g.67356694A>G, NG_032977.1:g.54331A>G, NM_001258214.1:c.1258+5605A>G, NM_001258215.1:c.1258+5605A>G, NM_001258216.1:c.1258+5605A>G, NM_001319233.1:c.1258+5605A>G, NM_001559.2:c.1258+5605A>G, NR_047583.1:n.1898+5605A>G, NR_047584.1:n.1898+5605A>G
    2.

    rs452204 [Homo sapiens]
      GCCTCAACATGCAGGCGCTTATTAT[A/G]ACTTCTGCTTGCATCATCCTATTGG
      Chromosome:
      2:113131484
      Gene:
      IL1RN (GeneView)
      Functional Consequence:
      intron variant
      Validated:
      by 1000G,by 2hit 2allele,by cluster,by frequency,by hapmap
      Global MAF:
      G=0.4950/2479
      HGVS:
      CM000664.2:g.113131484G>A, NC_000002.11:g.113889061G>A, NC_000002.12:g.113131484G>A, NG_021240.1:g.18592G>A, NM_000577.4:c.264+327G>A, NM_001318914.1:c.216+327G>A, NM_173841.2:c.327+327G>A, NM_173842.2:c.318+327G>A, NM_173843.2:c.216+327G>A

      Supplemental Content

      Find related data

      Recent activity

      Your browsing activity is empty.

      Activity recording is turned off.

      Turn recording back on

      See more...
      Support Center